Archive of Our Own ^beta

Chapter Text

"C'mon, Marianne. You're better than this."

Princess Marianne, Fairy of the highest rank, Hereditary Leader of the Armies of Mars and Future Queen of All Enlightened Space paused in her patrol, expression chilling as surely as water on Ganymede. She turned to the holographic image that floated beside her.

"Better than what, exactly? Is there a more worthy task than ensuring the safety of ten billion souls?"

Roland grimaced and looked down the corridor he had found his former fiance guarding. Row upon row of jars surrounded them, stretching far into the distance, until the haze of the cool chamber obscured them from sight.

These were not even the special bottles, lovingly crafted and made unique by family or servants to hold a loved one until their skills were once again needed. No, the jars that now surrounded them were simple, ugly things, most without even a label to differentiate one from another. Just endless rows of identical jars, each holding a single black bubble inside.

"Souls? They're Earthlings. They aren't sophisticated enough for souls."

Marianne bit her tongue to prevent herself from exploding on Roland. It would do little good, and he was only expressing what most other Fairies believed. Earth-based Life Forms, or E.L.Fs, were pitiful in comparison to the humans that had risen from Earth's ashes. Even she could admit that sometimes.

Not that Roland noticed her silence, prattling on with that condescending tone he was so good at that was almost - almost - as irritating as his physical presence. "Anyways, if you're going to patrol a useless building, why don't you at least focus on the areas with people. Might as well get a laugh out of doing your duty, right?"

"Had you considered, Roland, that I chose this task to avoid people?"

It was true enough. The press of all her social responsibilities sometimes weighed on the Crown Princess, a concept that Roland had never understood. Standing in the silent, echoing halls of forgotten humanity was comforting, especially after a particularly embarrassing dinner or harsh council criticism. These halls were a reminder that no matter how much she screwed up this grim mausoleum could never be destroyed.

"C'mon, Buttercup, let people see that pretty face of yours. Remind them that you're still kicking."

She sighed, but Roland had a point, damn him. If she stayed on deep patrol much longer people might start to wonder if she had bubbled herself just to get out of her responsibilities. Certainly she wasn't the first woman in her family to have considered it...

But no, as nice as curling her wings around herself and hanging silent for a few centuries sounded, she wasn't going to run away that easily. It was just what Roland wanted. So instead she stalked to the nearest transfer plate, dismissed Roland's chattering image, and sent herself over to the awakening bays. At least she would have a few minutes of peace before Roland hacked his way back into her system.

---------

The Awakening Chambers could not have been more different from the cool corridors she had left. She materialized in the atrium of the wing and was immediately assaulted with warm light and the sound of tinkling water. She stepped from her plate onto smooth olivine, and took a deep breath of sweet air. Technically she did not need earth-like air to breath, but there was something about it that every Earth-descendant, from the original E.L.Fs to modified humans like Fairies, could not quite replicate from recycled oxygen and nitrogen.

In fact this air was specifically designed to seem closest to old Earth atmosphere, of course without all the pollutants that the E.L.Fs had lived with their whole lives. Many would find themselves able to truly breath for the first time upon leaving their bubble.

Everything else about the building was also designed to be comfortable to E.L.Fs as well. Once they left the holding chambers they would be in for the shock of their lives, but the Awakening building was designed to lessen that shock as much as possible. No windows, only panes of light mimicking Earth sunlight rather than the weaker light of Mars. Simple, unmodified plants, carefully chosen to look similar to those even the most impoverished Earthling might recognized. Blue-grass grew around the fountain, with vines on the walls and bamboo in the corners. Flowers from every continent grew in solid planters; pansies to peonies, lotus to lilies, dandelions to dahlias; all lending their soft scents to the room. No music played, but there were timeless plantings on the walls between leaves and vines, mostly Asian landscapes but also African patterns and European pastorals. In a word, welcoming.

Not to a Fairy or Martian, of course. But to an E.L.F it looked somewhere between a utopia and a doctor’s office. At least, that was the intent.

There were some E.L.Fs wandering the room, but these were clearly either family members of someone Awakening or visitors to the Museum. They all respectfully bowed their heads and moved aside as Marianne appeared, though likely they didn’t recognize her but only the Armed Forces uniform she wore.

Roland would have encouraged her to question the E.L.Fs, if just to flaunt her authority, but she could easily read their auras and see their purposes. All green, all cleared to be in the facility, and that was enough for Marianne. If she had truly wished for more information she need only focus her second sight on one E.L.F or another and her internals would supply everything she needed with a helpful text ring around the E.L.F in question. No need to embarrass the elderly man or the young mother anxiously waiting for news. Let their children hold onto their illusions just a little longer.

Her patrol could take her either direction; left to the end of the Awakening route, to which all the E.L.F families were looking, or right to the beginning, where the Atrium hugged closest to the catacombs she had just come from.

It was really no choice. She always took the same route, following the path her mother had lead her on time and time again, ensuring that Marianne never forgot her lessons.

So she strode on, only glancing briefly at each guest, before continuing her patrol, her feet taking her away from the public areas and on into the Awakening rooms.

Then she slipped through a wall into a service entrance, door clear to her eyes but hidden from all civilian personnel. No one had accidentally discovered it, that much was obvious from even a cursory glance, but it slipped her out of sight and into a much more controlled environment.

The beginning was always the most dangerous, for both ELFs and the Fairy staff of the Bubble Repository. ELFs came out of their bubbles disoriented and - quite understandably - scared; the horrors of Earth’s fall still fresh in their minds. But the Fairy staff were well trained and there were lesser Forces personnel standing by to assist. Each nodded to her as she walked by, polite but more interested in their jobs. Every staffer had their own room, each outfitted for the Fairy’s specialty but all in calming cream tones that would remind the ELFs of Earth doctor’s visits and safety.

Marianne only briefly glanced at the staffers, confident in the both the Forces and Awakening technicians. Today there appeared to be only a handful of either in the facility. One staff member sat before a bank of monitors, carefully cued up a bubble, sending commands over their personal connection to the over-net, confirming with elegant hand gestures the specifications they were looking for. Another prepared a medi-bay for an ELF who had been marked down as in need of medical attention post-bubble. A third had activated a containment field as she examined a de-bubbled ELF who seemed shell-shocked and malnourished - very common for Earthlings who had been taken from poorer areas. In other rooms staffers inoculated ELFs against modern diseases and fixed any lingering Earth illnesses or simple genetic conditions. There were only a few Fairy guards, but all were focused on their private views of the rooms they monitored, ready at any moment to assist a staffer whose patient was not coming gracefully from their jar.

But there were no alarms while Marianne inspected the forty-odd rooms of the de-bubbling wing. There had not been an alarm for a good five months, mostly thanks to the over-net and staffers expertise when it came to choosing candidates for de-bubbling. Still, the guards remained vigilant, and Marianne saluted them before continuing on.

The second portion of her patrol was both easier and more difficult. Easier because these ELFs were already vetted by the doctors and specialists in the Awakening wing. Harder, because she forced herself to listen each time she did this patrol, just as her mother had taught her.

One moment she was in the quiet silence of the medical wing, the next she walked into a wave of sound, information coming from the hundred rooms of this wing, all encoded in the voices coming from the open doors.

Her wings raised and she put up her own shields, silencing all but sounds of danger and the voices from the nearest room.

“Tell me what you remember.”

A first session, then. The further away from the medical wing, the further one was along in their Awakening.

“Earth was attacked by - crystals, I think? Giant, huge things that crashed into the ocean. Bigger than buildings. They destroyed every city on a coast from the waves. I didn’t know, then. Too far inland. But there were too many people, all fleeing the cities, and no one knew what to do. I didn’t think it would touch us, but it did. There were riots, and they took our food away, and then - “

The ELF paused, tears streaming down their face. The Fairy staffer patted their arm kindly.

“Go forward a bit. To when you were bubbled.”

The ELF tightened their hold on the jar they had been kept in. For many, it was the only possession they had left. Marianne could see the callouses through the clear glass.

“We didn’t leave home on the first wave to Mars. We didn’t believe the crystals were really coming. But after...I didn’t care if bubbling just meant putting off the end. I couldn’t...I couldn’t let them live like that. If there was even a chance for a better future, I would take it. We volunteered for the second wave, anything that would take us to Mars.”

The staffer nodded.

“That’s where you are now. Mars.”

The ELF looked at her, tears still falling. “I don’t care about any of that. Where - ”

But Marianne turned away, blocking her mind from the question every ELF asked first, and moved on to the next room.

“Mathew, is it? Your documentation says you were a painter.”

This ELF was going through his job placement.

“Yes. It was only a hobby, but - “

“Things are different now, Mathew. We don’t need accountants or lawyers. Your skills with a brush will be more than enough.”

“How?”

Marianne could hear the smile in the staffers voice. “We collect energy from photosynthesis now. We need painters for the leaves.”

She moved on as the former accountant-turned-painter stuttered in shock and then gasped in wonder as he was shown the delicate lattice he would spend the rest of his days painting.

“How long has it been? You haven’t answered that yet.”

The next staffer sighed. “You’ve been here long enough. You’ve seen our technology - you’ve seen me. What do you think?”

“A long, long time?”

“Yes. 2,000 Earth Years.”

And the next.

“You have questions.”

“You have wings!” The voice of a child, and the staffer laughed.

“Yes, I have wings. All evolved humans have them. You might be able to make them, too.”

Unlikely Marianne thought. Wings were a manifestation of dozens of different powers, granted in equal part by the way that the bubbles warped consciousness and centuries of genetic manipulation to help the human race survive.

“And can you do magic?”

Another laugh. “It might seem like it, yes. But it’s not magic, not really. It’s science.”

To see a child de-bubbled was always heartening. Some ELF was waiting for them, and they would finally be a family again, albeit one in a world far, far different with rules that might not make sense. For at least one person, the question “where is my mother” would be answered with no heartbreak.

“So you’re saying you’re 'more evolved'? What the hell does that mean?”

“Simply put, humanity has changed a lot in the thousands of years since your home fell.”

“I get some of it - you’re taller ‘cus Martin gravity is lighter. You engineered your self better lungs and organs to last longer and not be in so much danger in space. We were starting to do that when everything when crazy. But the wings?”

“You’re file says you were a physicist. Do you understand the science behind bubbles?”

“Sorry to say that was way beyond me. They’re some kind of singularity, right? White ones can make endless power by warping space, black ones can store things in a bubble of space-time.”

“We’ve stopped using the white bubbles, but yes. What early humans didn’t understand - what Earth didn’t understand - was that one can make a bubble with only your mind.”

“What? That’s - “

“Crazy?” Marianne could hear the cocked brow as she paused by the door. “Like this?” Then there was a pop of displaced air and a gasp from the ELF.

“A bubble is simply a warp in space-time. For some reason - and no we aren’t sure why even now - being placed in a bubble opens the human mind to the higher dimensions necessary to manipulate bubbles. White and Black bubbles are merely the most simple of these. Our wings are manifestations of the more complex permutations. With them we can manipulate gravity, create what you would call force-fields, and create bubbles of slow rather than static time.”

“Jezus. Why the hell do you need me?”

The next room was quiet, the only sounds the turning of pages and the near silent drip of tears. Marianne didn’t need to glance in to know that the ELF in this room was alone, having been given time to themselves to process the new world and read the accounts of friends and family that had been de-bubbled before them and had since passed on.

Every citizen of Mars was required to keep a journal for this very reason. And though the journals were locked for as long as you were alive, they became public to the computers at death, and they gave a great deal of comfort to those who found themselves in an impossible future.

“What happened to Earth?” was the next question she heard.

“There are still humans there. Not everyone left or was bubbled. But they mostly live deep in the interior, away from the oceans. The crystals are still there, warping everything that gets close. They prevent all advanced mechanical technology from working, so the human societies have mostly returned to barbarism. But the planet itself is doing fine; global warming has stopped and infact begun to shift in the opposite direction. Pollution seems to be dissipating, and the animal populations that survived the original devastation are rebounding. The crystals have been good for Earth, but bad for humanity.”

“But that’s not fair!”

That wasn’t the only time Marianne was going to hear that statement. It was one of the most repeated sentences in the Awakening building, after the obvious one that began with “Where is - “ When spoken with the affronted tone the ELF in question was using Marianne had very little sympathy. This ELF clearly hadn’t felt the sting of devastation nearly as strongly as some others she had passed by. Anger she could sympathize with, though many Fairies considered the crystals the best thing to have happened to Earth. But disgust that Mars had done little to nothing to destroy the crystals was usually the next sentiment expressed by this kind of ELF, and she had no interest in listening to his bluster. Fairies were advanced, but even they had yet to understand the mysterious crystals.

“Wait, you have a crystal on Mars?”

“Yes.” The next staffer sounded as if she was explaining by route, and Marianne made a note to either give her a vacation or reassign her. “It appeared shortly after our terraforming efforts succeeded. However, it landed on the other side of the planet and we were able to alter our technology to function without mechanical components.

That is why our technology is so different than what you remember. We do most everything with organics and bubble-tech now. Such tech is far more resistant to the crystal’s field, and we do as much as we can with manual labor to prevent serious accidents.”

“Is that why you brought me out? To be manual labor?”

“Essentially, yes.”

Marianne shut the conversation out before hearing another “not fair” from an entitled Earthling. Painters and artisans, farmers and caregivers were all useful skills in the modern Mars. Roland would say the ELFs should be grateful they were being used at all, but the true unfairness was being discussed further down the hall.

“Mars is a hereditary monarchy with a council elected from among the other Fairy families. Leaders generally rule for 100 years, before abdicating to one of their children and remaining as either councilors or going into a semi-retirement. It is not uncommon for members of the Fairy court to bubble themselves for a few centuries and return when the world has need for their special expertise.

“The current royal family is led by King Dagda, while the Armed Forces is overseen by his daughter Princess Marianne. The second Princess, Dawn, is a major patron of this facility. The council is lead by 5 High Councilors which oversee the rest, with 60 members of the upper house and 180 members in the lower house. As an ELF you may only be elected to the lower house, but you will be expected to vote in your industry’s elections.”

History lessons, of the sort that Marianne had memorized as a child, coming from dozens of rooms around her, most saying the exact same things. She flipped through them quickly.

“Mars has a population of a little over 20 million. It was partially terraformed in the second century After Earth, and fully terraformed by a.e. 500. However the oxygen content is much less than that of your home planet, roughly equivalent to that of high altitudes. If you work on the trees, it is recommended that you carry a leaf-rebreather. Similarly, gravity is about ⅓ that of Earth, and it will take some time to -”

“There are no native Martian species, though some have been created through careful cloning. But Earthling species have been modified just as humans have. Genetically modified animals include Mammoths, dragon-riders, and cheshires. Insects may be larger than you expect, though they are nothing compared to the spiders used on our space colonies. Be aware that every creature on Mars has been specifically designed for a purpose so - “

“Water on Mars is rare and largely imported from space. The surface is arid, with artificial canyons providing water. Yes, we know early humans saw canyons from space, sometimes you did have good ideas.”

“The original underground cities are largely abandoned. There has been no need for upkeep since successful terraforming and such places are incredibly dangerous. Every year dozens of ELFs and quite a few Fairies are killed while exploring the under-cities. Please be aware - “

“How does our economy work?”

At this Marianne paused, forcing herself to listen, though she knew what was coming. Her mother had always insisted on it.

“Simply put, we have everything you could need. Food, water, sunlight, air; all that is free. Much better than what you had back on Earth, I imagine.”

The voice was familiar. It was Harold, one of Roland’s cronies. Of course someone like him would revel in taking the harshest part of Awakening.

“You are not required to work. If you wish, you can laze about just like you did back on your planet. Your skills are useful to us - that’s why you were Awakened - but you can be replaced, and we won’t send you back into your bubble unless you want to go.

“However - “ and Marianne shivered as she stood, just out of sight of the door, hearing the lizard smile in the Fairy’s voice.

“If you wish to see your family again, you will need to work.”

She could almost hear the heart of the poor ELF snap, and hers twinged in sympathy.

“Karen, is it? It says here you have a wife and three daughters. Children are ten years of labor each. Martian years, that is, which are about double the Earth year. Luckily, your wife only takes five, assuming she can work when she’s de-bubbled.”

He barreled on over the beginnings of the ELF’s protests.

“Don’t worry about the length of time, though. Ten years can also buy youth supplements, and you can always choose to care for yourself rather than family. Or switch on and off. If you are successful, you might be able to bring your whole family back. Some of our most productive ELFs spend centuries pulling their whole family out of bubbles, but I always wonder what’s the point if you can’t enjoy life. The choice is yours, of course. You’ll have plenty of time to think it over.”

There was silence from the ELF woman, the kind of frozen, brittle silence that came before a cacophonous shattering of anger. Harold was smiling, he probably even looked kindly, though Marianne knew his father’s fortune was based on ELF labor.

Marianne moved on quickly then, before the tears or anger came. There was a reason her mother had taken she and Dawn here every year on their birthdays. Roland had thought it was because Queen Juniper wished her daughters to feel superior to the pathetic Earthlings - just the way most Fairies did - but instead they had gained her fierce conviction that this was wrong and that no person, ELF or Fairy, should ever be forced to slave for the chance to see their family again.

If just to drive the point home, as Marianne left the Awakening wing, intent upon returning to the silence of the catacombs, she saw a reunion.

The old ELF she had seen earlier stood and his eyes lit up. A young blond ELF was being released; her handshake all that was needed to confirm that she was accepting her new life.

“Sen?”

The woman turned, eyes scanning the room but jumping over the old man.

“Sen.” He spoke again, and moved forward. “It’s me, Izumi.”

Her eyes widened, and now she rushed to him, eyes beginning to water.

“Izumi! What - what happened to you?”

“Sen!” The man gathered her into his arms, grip tight despite his age. “It’s been so long. I had to get our children out first. I’m so sorry.”

She shook her head into his shoulder. “No, I understand. I would have done the same.”

“They’re here now. I told them stories about you every day so they would remember. Sakura has children of her own now, see?”

The young mother stood and walked over, hesitant. “Mom?”

The woman turned and gasped. “Sakura? You’re - “

“Ami would have been here, but she’s at school. She’s fifteen now. I’m thirty five. And dad…”

“Eighty. In Earth years. Sakura’s older than I was when we were bubbled but - “

“I don’t care!” Sen insisted, gathering her family to her. “I love you. All of you. I don’t care how long I had to wait!”

Marianne turned away, pain curling in her gut. She had seen the contract Sen had signed, promising to work to regain her husband’s health before she had even seen him. That kind of faith - that kind of love - was everything she had wanted. What she once had, in the form of her perfect shining knight.

Now she had a restraining order keyed into her shields to keep the man that she had loved away. Needed to, because he stalked her every moment and manufactured dangers so he had the excuse to override her protocols and rush to her side. He showed how hollow his love was, but now every day more and more of her people sided with him, won over by the same beauty that had blinded her.

And she could never explain why she had chosen so suddenly to break the engagement, to call off the wedding and scandalize a whole world. Because she had found out his true nature by violating his privacy in the most heinous way. She had read his journal.

But that was all that had saved her.

So she fled from the bitter-sweet reunion, back down into the darkness, away from light and love and everything that her home was supposed to support. Maybe, just maybe, she could forget for a bit how her people took love and twisted it into ugliness, just as Roland had, if she stayed in the darkness alone, surrounded by nothing but memories and bubbles. Here, at least, Roland would never dare to sabotage. It was the safest, most secure place on the planet.

Which is why it was rather strange when, two hours later, she found a mechanical cockroach stealing through the halls.

Chapter Text

Princess Dawn was reading stories to the children.

At least, that was how Suni thought of it. He was an E.L.F, and so couldn’t help slipping into Earth thinking occasionally.

Like now. Before him, sitting elegantly upon a dais, bathed in weak sunlight and surrounded by children, Dawn was speaking aloud. Without his glasses, that was all he saw, but the children gasped with wonder and awe as they perceived the pictures Dawn painted in their minds.

Well, not directly in their minds. But most Fairies had a subconscious connection to the massive computer network that ran through all of Mars. ELFs could request eye upgrades to allow them to see as Fairies did, which is why the group before Dawn was equally ELF and Fairy, with a smattering of other sorts of children as well.

Suni had an allergy to the sprays, though, and had to depend upon ancient technology to bolster his dull earth senses. He would have to tune his glasses to the exact private channel Dawn was using and concentrate hard to see even half of what the children saw.

But he didn’t need to see the fantastical landscapes and amazing creatures Dawn conjured up for her students. Her voice alone was enough to enrapture him. High, clear, and full of emotion, Dawn could awaken a stone with her stories. He could listen to her all day and never be tired.

But today he had a job to do. So he settled his glasses more firmly on his dark face and returned to updating her itinerary, managing her media presence and curating her messages, and all the while keeping an eye on her useless body-guard.

Roland was supposedly everything a Fairy should be. Tall, broad shouldered and regal, with a perfect smile and immaculate blond hair, he was the one everyone wished to be King. Acting as bodyguard to the Royal Princesses seemed a fitting task for a man of such potential.

But Suni sided with Marianne on the issue of her ex-fiance for purely practical reasons. While Suni answered Dawn's messages and planned out her daily schedule, he was also scanning the local security networks and tracking any suspicious movement; exactly what Roland should be doing, except for the fact that the Fairy Knight was gazing off into the distance, bored look on his face whenever his eyes focused enough on the scene before him to even register the Princess. Suni knew he was stalking Marianne through the network, and as the man gave out a snort of irritation Suni could guess that the future Queen had once again shoved Roland out of her personal system.

Out of the corner of his eye Suni watched as Roland’s handsome face darkened and his fingers began to twitch, a sure sign that he was using his Armed Forces clearances to hack his way back into Marianne’s system and somehow into her good graces.

Never-mind that Suni was no soldier, never-mind that he was an ELF, at least he was capable of doing his job . He was the Princess's aid, and Roland was supposed to be her protector for the day. But if anyone ever caught Roland shirking his duties the perfect prince would just smile and claim that he could protect two princesses at once, and really, what harm could Dawn ever come to?

Suni mentally gritted his teeth at the thought, but kept his face pleasant and polite. It wouldn’t do to grimace around the children, especially with the few Fairy parents in the audience sneering each time they caught sight of him. Suni’s mere existence was bad enough; then he had to go and become personal assistant to the second Princess, stealing the job from half a dozen under-qualified but well-connected Fairy candidates. Many would jump at the chance to see him re-bubbled and his corrupting influence - the same influence that supposedly pushed Dawn into allowing ELF children into her story circle - safely contained.

Suni wasn’t sure which was more impossible; the thought that he would ever do anything to harm Dawn, or that she was so weak willed as to be swayed by someone like him. But he could understand the distaste. After all, Suni wasn’t just an ELF, but the most archetypical ELF imaginable. He was small and dark; tiny from malnourishment as a child and dark in a way that wasn’t ‘exotic’ enough for the elites to find handsome. He had no apparent talents, no skill with the brush or ladle, and jealous Fairies of the court were always eager to point out that he had been the last of his brothers and sisters to be Awakened. Even his mother recognized him as useless, they said, though Suni had never begrudged her for her practical actions until those actions were constantly thrown in his face.

In his worse moments, Suni sometimes wondered if Dawn would have even noticed him had he not grown up at her side, the only playmate who was so unimportant that he could be trusted with all the secrets the court would have loved to get their hands on.

But that doesn’t matter he told himself for the hundredth time that day. The sneers and rolled eyes were nothing when compared to Dawn’s smile, and his every action made that smile more likely.

So when the story finally concluded with cheers and swoons from the children he was ready. While the applause ran its course - enthusiastic from the children, polite from the adults - he sent over the next few events of the day; a private lunch with the handsome Fairy Leon, a meeting with a committee of ELFs wishing for the King’s ear, and tea with a group of the court ladies.

While Dawn accepted praise from parents and asked about the children’s studies she was also confirming and editing her itinerary, modifying it here and there and sending quick messages back to Suni.

He tried not to smile too broadly at the emoji and sparkles she managed to add to every message, even if it was only for his eyes.

“Tone the walls more green for the meeting, Suni. Most of the committee members are from the high trees; they’ll appreciate the cooler colors after spending so much time in the sun! Thanks! <3”

“Ooooh, switch out the Assam for prickly pear juice. We’ve just got a new crop in and I can’t wait to see Madam Honeybum’s face when she realizes she’s been grimacing at her own product! XD”

“Leon? No, I don’t want to have a date with Leon . Aaron is the handsome one!”

At the last message Suni winced. As much as he loved her, managing the young men in Dawn’s life was a nightmare. Quickly he sent a request to Aaron, pulling up the messages the young noble had written Dawn in the last few months and sent them over to refresh her memory, along with a quick summary of his relations and their businesses. Then he drew up a map, noting where Leon was approaching and gauging how quickly Aaron would walk if he could guarantee an audience with the princess.

Six minutes, more or less, given that the Fairy boy would not wish to seem too eager, and that he was likely skimming through all his information on the princess just as she was doing for him.

Which meant that he had to stall Leon now .

A timer began counting in Suni’s mind, and at the corner of his glasses. Four minutes until Dawn finished with the audience, but Leon’s parents would ensure that they were the last to speak with her. So a minute and a half before Leon arrived to be introduced.

Carefully Dawn drew out the conversations with the other parents while Suni moved casually through the crowd to the path Leon would be coming down. He ruffled the hair of ELF children who were almost taller than he was, and dodged not-so-subtly hidden tripping hazards left by Fairy brats.

He timed it right, and intercepted Leon just as his parents began looking around for him.

“Sir? About the - “ without a pause he checked the general event calendar for the next event Leon and Dawn would see each other. “Riding party next week? Princess Dawn was wondering what kind of dragon you will be using.”

“What does it matter?” The Fairy boy asked, craning his head around Suni’s hair to see where Dawn had disappeared to.

“Well, the Princess was rather hoping that we would have a rainbow of wings, and she mentioned that you had a fine red mount that would be perfect to lead the procession.”

Leon paused, long enough that Suni knew he was checking his stables for the imagined mount. “What? Oh, yes. Delicious. Er, that’s the name of the Fly, I mean.” Suni imagined that right at this moment a new mount was being requested for the Balderdash family stables, the best that their prestige could afford, and the name changes being pushed through according to the boy’s whims. A crafty look grew on his face and he added, “What will Dawn be riding? Wouldn’t want to look better than her, right?”

Of course you want to look better than her . Suni thought to himself. You don’t get a chance to show up the royal house often. But he said,

“I believe Dawn will be riding a white Dragon-fly with blue wings.”

“Ah, then we’ll match. Perfect. Now out of my way, ELF, I have a date with your mistress.”

Suni bowed and the fairy pushed past, only to be met by glowers from his parents. Dawn had already left, graciously taking Aaron’s arm and waltzing away to her private lunch. Suni would be best gone before Leon remembered who to blame for his perceived failure. Now which way had she gone…

For a moment Suni froze, Dawn having disappeared from his map. Terrible fears flashed before his eyes, before he remembered that the easiest route to the lunch pavilion would take her beneath The Queen’s Room and thus out of signal range. He heaved a sigh of relief and began hurrying after her.

----

One of the benefits of not having an internal connection to the ‘net was easily being able to see short-cuts. Where most would merely see walls and planters, empty windows and artfully constructed tapestries, Suni saw openings everywhere. Here there was a servants’ entrance, hidden behind a screen of fake ivy and built with the short stature of most ELF’s in mind. There was an opening half way up the tall walls, perfect for a flying Armed Forces fairy, only visible to those who had clearance...and Suni, who could see the bones of the palace each time he looked over the edges of his glasses. Everywhere was augmented with great digital art, hung up on the bare stonework, set next to physical paintings and sculpture.

Most ELFs and Fairies would never notice the difference between real and projection, except perhaps as a medium notation upon the plaque that hung by each piece. And no-one would think to remove their glasses to see the passages hidden in plain sight. If they did, most would think - correctly - that such places were restricted if they could not regularly see them.

Perhaps only the royal family had a true map to the palace; everyone else merely seeing what their clearance allowed them. Soldiers saw one map, servants another, guests a third. But Suni had pieced together something close a full picture through trial and error over the years.

So when he needed to catch up to Dawn he skirted the public areas, moving quickly through the courts and walking paths of the Fairies and their Courtiers. These areas were beautiful, an equal number open to the elements and lightly covered by shade-trees and lattice pavilions. Suni didn’t stopped to marvel at the stone, grown into formation in the same way ancient gardeners had grown hedges into fantastical shapes. The palace itself was far more impressive; towering four dozen stories high and looking as if it had been grown from spun stone.

He ducked through an entrance hall quickly, though it was difficult to tell the difference from inside and out, given the immensely high ceilings and ‘net-screened windows. Luckily he only had to dodge his fellow ELFs; any fairy on business simply flew through the palace. It had been designed with their proportions in mind, after all. To his eye the hall was built from creamy red stone, laced through with local crystal and minerals, but the others saw whatever overlay their eyes were keyed for: the servants saw something quite similar to him, unless they had a particularly nasty supervisor or a vindictive fairy brat who could turn the rooms into dark dungeons or arid deserts; Fairies could see whatever their minds wished, within reason and with the knowledge that when the King wished to make a speech everyone saw the palace as he wanted - usually tall and shining and white, for King Dagda was an old-fashioned man who stuck to the classics.

From there Suni slipped into a servants’ entrance, nodding briefly to a brother’s-fiance’s-cousin’s-aunt (at least, that’s what his relation chart told him) who worked in the kitchens. Her eyes glanced over him, and he wondered if her supervisor did not allow outside conversation among their workers. Alternatively, Hanita might simply dislike him. Just as many ELFs hated Suni for his role as Fairies, and for the similar reason of his perceived weakness in comparison to other candidates. It was difficult to convince anyone that his complete lack of importance was the very reason King Dagda allowed an ELF to stay so near his flighty daughter.

Suni tried not to be hurt by the slight and hurried up a hidden pair of stairs to a guard corridor that ran perpendicular to the servants’ hall. This one was stark, seemingly cut directly into the red stone but with a high arched ceiling for the flying members of the Armed Forces.

Sometimes Suni wondered what a map of the palace would look like with all the secret passages included. It was already seemed more air than stone thanks to clever tricks of light and ‘net-screens, but it might be true in fact, with every wall hiding at least a few extra corridors. Some of the corridors weren’t even in the walls, merely hidden by screens, though Suni could bet that even without the immaterial walls the Fairies wouldn’t see the hurrying ELFs.

Before finally reaching the lunch pavilion on the twelfth floor Suni took two more servant’s corridors and six more guard paths. The first servant’s hall was a gardener’s and Suni needed to edge around plants from all over Earth and dozens genetically engineered for Mars. Then he took a kitchen elevator, normally reserved only for food for the fairy elites, to Dawn’s wing. Presumably her lunch would be following shortly thereafter. That deposited him right before Dawn’s lunch balcony, which had a view befitting a Princess.

The whole trip had taken him a little less than six minutes; far shorter than that of a regular ELF, who might be commandeered by any Fairy who saw them, never mind their responsibilities.

As it was, he appeared just as Dawn rounded the corner, Aaron in toe, and all his work was rewarded by the look in her face when she saw him.

Dawn beamed . Her bright, sweet face erupted into a smile, blue eyes twinkling and cheeks dimpling as she saw her friend.

Aaron’s face fell as Dawn dropped his arm and hurried to Suni, saying, “ How did you beat me here? I saw you still in the garden ten minutes ago!”

“A butler has his ways, Princess.” On any other man the words would have seemed condescending, but Suni flushed and ducked his eyes, the words spoken from somewhere beneath his collar.

“You’ll have to show me those ways sometime, ELF.” Aaron said, smoothly trying to take Dawn’s hand again.

The Princess chuckled and tapped her date reprovingly on the arm. “One doesn’t ask a man to give up his secrets, Count! I don’t need to know how Suni does it, just that he will always be there when I need him.” Never-mind that she had grown up in the walls just as Suni had, and was alone in knowing his secrets, just as he was alone in knowing hers.

Aaron’s smile hardened as he stared down at the ELF who had stole the Princess’s smile. “One would hardly think you would need an ELF for something so simple as lunch.”

Suni’s smile looked far more genuine than Aaron’s, if just from years of long practice. “I am merely here to open the door, Lord Aaron. And to take any extra requests for lunch.”

“I can call a servant on my own, I assure you. Begone.”

Suni bowed low, reminding himself that in some cultures keeping one’s eyes off an enemy was a high insult (never mind other cultures that thought it was a sign of high respect. An ELF took insults one could get).

When he glanced up he saw Dawn rolling her eyes behind Aaron’s back, and any bruised feelings disappeared with the message she sent saying, “What a boor ! And a bore too! Sunny, strike him from my schedule. Mr. Right had better not ever treat my friends like that!”

------

While Dawn ate and made small talk with Aaron, Suni found himself wandering the route she had taken, through the wide, impressive halls, half-open windows reflecting a million colors on grey stone and green marble and pale red sandstone, giving each room its own ever-changing rainbow.

He came out in the Queen’s Room, one of the largest rooms in the whole palace. Here the walls were white, but not the cold white of some of the outer pavilions, but rather the warm, living white of milk and cream, accented with gold. Wide columns graced the walls.

The room always reminded Suni of pictures he’d seen of ancient cathedrals. Catholic, not the intricately decorated mosques of his mother’s faith, but not so cold. There was even what looked like an alter, taking up the whole back wall, showing a bright, rising woman with wings closer to angels than fairies.

The king sometimes gave speeches here, so there was a gold dais just below the clear crystal bubble the stature held in her soft marble hands. There were cushions scattered on the floor and chairs in the various balconies that looked into the room, just like the one he was on now. Stairs were cleverly concealed into the columns, but he did not descend, wishing to remain on hand should Dawn need him.

Of all the rooms in the Palace, this was the only one used equally by Fairies and ELFs, as the Queen would have wanted. The main audience chamber was off this room and each member of the Royal Family had a private balcony which lead into their personal rooms. In many ways this room was the center of the Palace. And thus, to a certain extent, it was the center of Mars.

Suni rested his hands on the low wall of the balcony and looked at the Queen, for that was who the statue portrayed, in all her regal glory. She was so like Dawn. The sculpture had captured the warmth in her smile and the kindness in her eyes. The bubble in her hands might as well be the whole of Mars, for her love for her home had been legendary, and the loving way she cradled it reminded all, Fairy and ELF alike, of the space they held in her heart.

Suni barely remembered the Queen, and saw her now mostly through reflections in Dawn. She had been a kind woman, with warm hands and a open smile. But the statue did not capture the firmness he remembered, preferring to only show the softness and love, not the will of steel that both of her daughters had inherited. Easier, perhaps, to remember the warm woman rather than the steel that had lead her to bubble herself for her convictions.

“She was the Heart of this kingdom, you know.”

Suni started from his daze, surprised to have his thoughts echoed by Roland of all people. The man had snuck up on him somehow, probably flying from one of the other balconies.

“Dawn looks like her.” was all Suni said.

“As does Marianne.”

Suni squinted, but couldn’t see it. Marianne took after her father in everything, from coloring to temperament, which was likely one of the reasons the eldest Princess and the King often got in legendary rows. In some ways, the arguments were the closest relation Marianne had to her mother.

“Beautiful. Fragile. Like a flower in the sun.”

All certainly true of Dawn. But...Marianne? The Warrior Princess? But Suni kept his comments to himself. It wouldn't do to insult the captain of the guard.

Roland smiled sadly. “I love her, you know.”

That, at least, Suni could understand. He looked back to the statue. “Yeah.”

“If only I could win her heart again. If only...If only there was a potion that could make her see me for what I really am .”

Suni didn’t see the calculating look Roland gave him out of the corner of his eye. Instead he sighed forlornly, Roland’s words hitting close to home and making the knight hide a smile.

“Yeah. But nothing like that exists.”

“Don’t be so sure, ELF. What if I told you a way to win her heart did exist?”

Suni looked up at the Fairy Knight. “I’d say you’re crazy. And guilty of treason if you think I’d ever let someone douse a member of the Royal Family with a potion to force their will!”

Roland held up his hands. “No, no! Nothing like that! The mere thought !”

The ELF raised a brow. “Then what, then?”

“What if I told you there was a potion that could de-bubble anyone?”

“I’d say you just have to go to the Awakening building and ask for who ever you want.”

“Not just an ELF or lesser Fairy. Anyone .” Roland paused, and looked meaningfully towards the alter. “Even someone who no-one else can reach.”

Suni’s eyes went wide, and he looked towards the crystal globe.

“Anyone? Even…”

“Even the Heart of Mars. Wouldn’t that be enough to make any girl love you? If you brought back her mother?”

Chapter Text

Every society needs boogiemen, even Mars. From before humans were human they had told little ones of the dangers of the dark, of fierce beasts and grasping hands.

Mars had its dangers just like any other world. Where once humans had feared heights and the cold of space, now the dangers were from bubble accidents and faulty augmented realities. Bubbles could be lost, or a fairy insulted enough to terrorize a whole family. Often a child could not understand the reasons for the rules, but they could be given an appropriate monster to scare them into compliance.

And it happened that Mars had one readily available.

---------

Marianne thought of this as she followed the strange device deeper into the catacombs.

Fairies, in general, avoided mechanical devices. The more complex a machine, the more likely it was to fail should it fall into a Crystal field. Organics were far more resilient,so fairy tech was mostly a combination of bubble power sources and bio-machines with the minimal amount of metal in any given device.

But the tiny cockroach that trundled down the corridor was completely mechanical and a work of art beyond. Marianne had never seen its like, and that alone would have led her to follow it into the dark. Wondering about its origin was what led her to pull her wings tight around her, easing out of gravity and bending the grey light around her into invisibility. She had no idea what sensors the cockroach held, so it was better to be safe. Who knew what it would do if it realized it was being watched.

Silently she followed it, toes barely touching the metal floor to push her forward in a loping bounce. Outside she would fly, but the cockroach was so small she was afraid she’d lose sight of it in the gloom.

Deeper and deeper she followed the toy into the catacombs, so far that any but her would have been lost. No one but her visited this deep, or so she had thought. Yet the roach seemed certain as it navigated its way deeper, only occasionally pausing to swing its eyes towards the labels on the jars of the lowest shelf.

That in itself was strange, though not as strange as the direction the cockroach was traveling. Any creature connected to the ‘net would be able to track their progress through the bubble-vault; the data easily accessible on the logic that anyone who had the clearance to be in the vault would also have the authority to read the histories and stories of the ELFs stored there. But this creature actually read the labels, some so old that the ink was barely legible despite the carefully temperature controlled climate.

Deeply strange, but also clever, given that the over’net would register any unexpected activity. And this was certainly unexpected. Had Marianne not already had a good idea where the cockroach was going, she would have been completely perplexed.

The little creature had long passed the ‘popular’ bubbles, those of actors and politicians, people who were brought out often for interviews or autographs and then returned just as quickly. It passed by the doctors and scientists and artists of all sorts, those brought closer to the front in case they were needed on short notice. And it kept going, passed the rows of children, of the poor who were high on potential but low on education, of those who had intentionally been left behind by their family (like Suni’s father, who had been relegated to the depths by joint agreement by his whole family, and quickly replaced by a kind Ethiopian chef who everyone far preferred, especially Ma Dai). And then on, passed all the people with professions and skills that no Martian had need of; unpopular politicians, lawyers, generals and mercenaries and managers.

No, none of these were what the cockroach wanted, and so Marianne was not surprised when it trundled and clicked its way passed seven billion people without so much as a second glance. It only paused as it approached the very, very far reaches of the vault, miles underground and quieter than the grave.

Here were the damaged bubbles. The ones that had given rise to Goblins.

-----------

“Don’t go outside after dark.” Marianne remembered her father telling her as a child. “Or else the Goblins will steal you away.”

“Eat all your food, or else the Goblins will eat you .” Ma Dai had said, ladeling more lentils into her bowl.

“Never explore the old tunnels.” Her tutor warned. “That’s where the Goblins live.”

“Sleep sound, else you’ll turn into a Goblin!” from Dawn, repeating what her nursemaid said over and over.

“Always watch the shadows…”
“Never ask questions…”
“Don’t look for old cities…”

Countless warnings, repeated by mothers and fathers and teachers to every child across the planet. As an adult it all sounded the same to Marianne. Fear the dark . Don’t step out of line. Don’t question the way things are .

Only her mother seemed immune to it.

“Make your bubble strong, dear. Protect yourself from the radiation.”

“But why mummy? Isn’t radiation what gave us wings?”

“Our powers come from the other-space. Where you go when you’re in a dark-bubble. But a bad bubble can let bad things in, things that hurt you and will make you come out different. That’s how goblins are made, sweetheart.”

The little Marianne hadn’t believed it. “I thought goblins were ELFs who were really bad and got what’s com’n to ‘em. That’s what Roland says.”

Her mother’s beautiful face had clouded and her lips drew into a thin line. then she put her hands on Mariannes cheeks and looked deep into her daughter's eyes.

“Listen to me, Marianne. The Goblins and ELFs have done nothing wrong. You must remember that. The only thing they chose was to come here, and entrust their fate to us. It is we who have wronged them, by keeping them in bubbles too long and putting them at risk. Someday we will open all the bubbles, and free all the ELFs, even the Goblins. It is our duty as stewards of humanity. Promise you will remember this, Marianne. This is our duty.”

Queen Juniper’s words had resonated with Marianne, even as a child, taking up residence in  her mind despite not truly understanding what her mother meant. The words duty and fate took a place in her heart long after her mother had turned her back on Mars in despair and left her daughter to fight alone.

One day Marianne would be Queen of Mars, just like her mother before her. When that day came she would rule more than just the citizens of the light. She would rule all her citizens fairly.

Even the goblins. She had a duty.

And for too long had rulers ignored the plight of those who hid in darkness.

---------

As an adult, Marianne knew that Goblins came from damaged bubbles, ones that had not been made properly. The fault was rare, affecting perhaps a tenth of one percent of the dark stasis-bubbles. Most such bubbles came from cities near where the crystals had landed, leading many to believe that it was the crystal’s anti-technology field that caused the faults, not human error. Whatever originally caused it, the faults even appeared in later bubbles, those better insulated and better constructed. Far less frequently now, especially with the lower population loads of Mars, but still something worth warning unruly children of.

No one knew exactly what caused the Goblin mutations. Fairy mutations were almost all mental, coming from the mind opening to higher dimensions through an intense experience with one. Goblin mutations were physical, leading warped bodies and twisted features. The general theory was that radiation leaked into improperly shielded bubbles, but that did not seem to account for just how changed Goblins were. Nor the fact that they generally survived the transition, despite often looking like completely different species.

Marianne was partial to the theory that some bubbles shifted into an alternate reality, rather than simply failing to pull the inhabitant completely out of space-time. It would explain why so many goblins came back with memories that weren’t quite their own, and dreams they couldn’t explain. Perhaps in this other reality they really were frogs, or fish, or strange long dead insects.

But it had been centuries since any goblin had been Awoken. The computers had learned to recognize the faulty bubbles, and the fairy council had decided to remove all Goblin bubbles from the awakening roster. The creatures that came out could hardly be recognized as once-human, and they rarely integrated well into society surrounded by ‘normal’ ELFs and Fairies. No matter the genius a goblin possessed, they were deemed too dangerous to bring into the light.

Yet somehow they survived, hiding out in the old underground cities, supposedly stealing misbehaving children and forcing them into faulty bubbles so they could grow their population. Other stories simply said that missing children were eaten. Marianne doubted both, given that the old cities were famous for their near-indestructible hydroponics systems which once had fed a Martian population triple the size it was now. More likely the goblins only raided when they needed medical supplies or a bit of sunlight. Or perhaps they liked terrifying the rest of the Martians. Marianne certainly couldn't blame them for the latter.

But the question still remained - how were the Goblins breeding? There was no doubt they were still down there, even centuries after the ban, and so many goblins were infertile that without the advanced bio-medicine of the Fairies it would almost be impossible to have children.

Marianne suspected she had just answered that question.

--------

Finally, the cockroach stopped, in a dusty corner that Marianne herself had never visited. The clean, careful care the rest of the facility received was apparently forgotten here, some jars merely piled against the back wall, their labels obscured and unreadable to the computers. Lost, forever. The sight made Marianne grimace behind her shield of invisibility. She had told the staff, over and over again, to at least find shelves for the Goblin bubbles, but even in a world of limitless resources apparently that was too much.

But here there were tracks in the dust, not fairy-light footsteps, but the tiny trail the cockroach left behind. As her eyes adjusted to the light, Marianne saw other such tracks, paralleling them into other dusty and abandoned corners. So this was not the first time the creature had snuck into the depths of the Bubble repository.

Now it was moving slower, and Marianne hung back, allowing gravity to ease further on her body and float her to the low ceiling. Elsewhere the bubble racks towered, but here the rock of Mars could be seen, and she slipped a hand out to hold the rough stone and anchor herself out of sight and sound.

The cockroach clicked to itself and examined the shelf before it. The jars and data Marianne could see were in a jumble, with ELFs from all different areas and backgrounds and families all lined up together, all order lost after the computers had been instructed to simply move the damaged bubbles away ; out of sight and memory, if the Council had its way.

But the cockroach seemed to know what it wanted. It - or at least its master - was looking for something specific. After a moment of mechanical calculation it clicked again and skittered to the edge of the shelf, then began to climb. Despite herself, Marianne felt a chill of revulsion; for a moment the creature looked too real, and instincts that had never been needed on Mars flinched away.

There were no cockroaches on Mars. There was no need for them, with decay done far more efficiently through composting and specially designed creatures. Marianne only knew the creature from old history textbooks and warnings for anyone who wished to visit Earth. But whoever had designed the mechanical roach had intentionally chosen its look. They were laying claim to one of the most despised parts of Earth, a thing that every ELF reviled and Fairies took as proof of barbarism. And they had made something brilliant from it, something that moved and darted just like the real thing. Marianne was impressed, now that she got a clearer look.

It found the correct shelf and dove in, disappearing from sight and into the depths. Marianne tracked its position, listening close to its clicking and occasionally seen a flash of reflected light as it brightened its eyes just enough to read a label.

Barely thirty seconds later it stopped, and there was a cautious clinking as it began returning to the corridor, pulling a jar behind it. Clink Clink, then a pause, then two more Clinks, and another pause. If Marianne had not been directly overhead the sound would have been swallowed by the silence of the crypt.

It reached the edge of the shelf and looked looked back, satisfied that not a jar was out of place except the one it had extricated. Then carefully, carefully, it maneuvered the jar onto its back and climbed down to the floor. Behind it there was no sign that the roach had ever been there.

When it reached the ground it opened the jar, sniffing first with its antenna, then reaching in and grasping the black bubble with its mandibles. Not an easy task, given how light and slippery bubbles were, but the cockroach had no trouble. Then, in an act Marianne had not anticipated at all, the cockroach swallowed the bubble. Seeming content with the act, it turned back to the jar, secured its top, then spat a thin spray of liquid at the label. Ink ran and Marianne sensed whatever chip had been implanted in the label decay as well. Whoever had been in the bubble, their information was now lost, unless someone physically found the jar.

Which would be difficult, as the next thing the cockroach did was push the jar beneath the shelf, the top coming loose again and looking for all the world as if the jar had fallen on its own and its bubble rolled away into the aether.

As the cockroach turned and began back the way it came, Marianne glanced around the vault, noting other jars on the floor beneath shelves or stuffed into odd corners. Even some of the piles looked as if they had empty jars, added to the sides and sporting just a bit less dust than the others.

So how long had the Goblins been doing this? And was she really the first one who had noticed it?

Chapter Text

Plans from Roland were always clever, Suni had to admit that. The man appeared like a complete fop to even some of his most enthusiastic supporters, so it was easy to forget that something had kept the man a staple of the court for centuries, and it wasn’t just his charisma. He exuded confidence and power, and seemed to always find innovative solutions to problems others might never have thought of.

Though somehow it seemed that Roland never was the one trudging through freezing underground tunnels on the way into goblin territory. Perhaps it wasn’t his cleverness or charisma that made him special, but his ability to delegate.

And, once again, Suni had fallen for it.

“I have here a map to the last known store of the Potion.” Roland had explained. “All you have to do is go get it.”

“And why can’t you come with me?” Suni had asked, trying to keep his instinct towards insubordination out of his voice.

“Why, because I’m too big! Some of those tunnels are tiny - even for a fairy child. Only someone like you could fit through them. I’ll stay here and guide you as best I can, and send help if you take too long.”

Which was how Suni had ended up five miles underground, clutching his glow-worm lamp and hoping against hope that Roland’s data had been right and that no-one would flush the water-pipes he was traveling through.

Roland’s com-link had cut off ten minutes ago, and Suni was trying to be charitable and believe that Roland had not know that would happen. The man was the epitome of a Fairy Ass but knowingly sending someone into Goblin territory without backup was a bit much, even for him...right?

But the further Suni traveled, the more convinced he was that Roland had at least spoke the truth when he said that only someone like Suni could come down here. Not just because of his size, though there were turns that even Suni had difficulty getting through, but because of the illusions.

The faded augmented realities hung thick in the stale air, broken and forgotten programs that had been shunted off into the darkness rather than ever properly turned off. With his glasses he could shreds of vast underground caverns, flickers of monsters, and rafting rapids. Such things were dangerous for anyone who could not easily turn off the illusions; there were holes and pitfalls and sudden drops created by time and shifting sands that the augmented reality ties hid. With maintenance the tunnels would not be too dangerous, but these were ancient systems, mostly unused now that most of Martian life took place on the surface and in the canyons. No one should be down here and if the faulty programs kept people away the Fairy government was happy to leave it be.

Suni had no idea if Roland’s map was any good. There was no way to know until he wandered face-first into a goblin den or was hit by a jet of water or sewage. It seemed that these tunnels were abandoned, and it was certainly true that any but the smallest elf would have difficulty moving through the smaller openings. But goblin-fungus grew on some of the walls, the mycelium eating into old pipes and giving off a faint glow. The heads let out clearer light and popped out of the walls at junctions and pipe crossings, strobing slowly from blue to white to green light. Others only activated after Suni had passed by, lit by the touch of moving air.

The deeper Suni went the more debris littered the ground, all damp rotted leaf-matter that was present in tiny cleansing particles in all Martian water but only clumped when pools had been left stagnant too long. The skittering of animals increased, mostly various rodents and insects that the Fairies had once needed for decay but had long since replaced with highly targeted bacteria. He saw a colony of ants, industriously hollowing out a tree-stump. He disturbed groups of bats and blind sparrows and once heard the pad of a cheshire pass by, invisible and stalking prey that Suni could only hope was tastier than he. These were all interwoven with their own augmented realities, some keyed to specific species to make them more ‘attractive', others instinctively generated by larger brains like hive-minded bees or escaped pets.

Most he ignored, though he stayed silent and wait for the cheshire to pass, unsure of how large it was. Time in bubbles did weird things to cats, more so than any animal outside of humans. Again he thanked his stars that the worst of the monsters were invisible to him if he just shut off his glasses. Now he was only keeping them on to follow the map that overlaid the shifting realities.

He was so focused on ignoring the illusions that he didn't notice the creature sneaking up behind him until it was nearly too late. One moment he was sneaking down a corridor, listening close for the tell-tale rush of water, the next he was back-lit by a bright light and a huge shadow looming behind him. He did not even consider that there were ways of creating illusions in the real world, didn't consider that the monster could be harmless, he simply dropped to the ground and waited for the end, screaming.

------------

Elsewhere on Mars, Marianne was sneaking down a corridor of her own. She was still hovering, invisible, above the scurrying cockroach, but only damn good luck had allowed her to follow it as it left the Bubble Repository.

The little creature had exited the Repository through a hole too small for anything but the tiny creature to fit through, beneath a bank of monitors close to the front of the facility. Marianne easily saw how it had managed to avoid tripping the sensors; some time in the past the new monitors had been added, bolted to the floor and the security system incorrectly re-worked around them.

Thoughtfully Marianne had modified the system to correct the oversight, but had left an instruction to allow the roach through. She did not want to alert its masters - at least not yet. Luckily her maps of the Repository were more complete than that of the normal worker or guard; compiled through her own exploration of the surrounding areas. She was able to drop her shield and run to the nearest fairy-sized entrance into the underground and catch up to the bug before it traveled too far.

The corridor Marianne was now traveling, safely back behind her invisibility shield, could not have been more different than Suni’s pipes. These were tunnels designed originally for humans. All were straight, with white tile floors and walls, darkened down to emergency lighting but still kept clean by infrequent snuffler patrols. But the roach seemed confident that it would avoid being caught by the shaggy vacuum creatures. Perhaps it - or its master - had mapped their routes. She could just barely see in the dust tracks of its earlier passing. But if the roach had left any signs of previous trips the snufflers’ brushes had long since obliterated any trace.

Not worrying about any observers, now the mechanical creature was going quickly, skittering down the corridors fast enough that Marianne had to push herself to keep up while also remaining silent: surprisingly difficult given her normally loping stride had her careening into walls every few moments. It had been a long time since she’d needed to be this sneaky and her rusty skills were obvious - at least to her. Luckily she was deep enough underground now that the walls were reflecting air-signals so no-one - Roland, her sister, the King - would be able to interrupt, or worse record her antics. Still, it would only be so long that she could stay down here without arousing suspicion. So the faster the creature went, and the closer it got to its master, all the better.

But perhaps she was concentrating too hard upon not slamming into walls, because she nearly slammed into something far more dangerous.

-----------

Suni’s screams died into whimpers over the next minute, then into silence as he heard a strange snuffling sound. Cautiously he peaked through his fingers.

Before him a huge white rat-like creature was rolling on the floor, clearly laughing its heart out.

He flushed and climbed back to his feet, brushing the mud off his pants as best he could.

“That wasn’t very nice.” He said to the creature, trying not to sound too peevish. Just because it was small and seemed friendly didn’t mean it wasn’t hiding some strange power. Certainly it was intelligent enough for it, if it went out of its way to scare the hell out of him.

The beast - an Imp, his glasses informed him when he set them back on his face - broke off its chuckling when Suni spoke. Big white ears flickered in his direction, clearly listening.

“I’m on a mission.” He explained, not sure if the creature could understand him, “For the Queen. It’s very important, and I need to follow this map - “ he tapped his glasses “quickly so I don’t get sucked down into the sewers or eaten by goblins. So distractions are a bad thing, okay?”

He turned to leave, only to have the creature tackle him from the back, tumbling him back down into the mud while it stole his glasses and peered through them, one eye at a time, chittering.

“Hey! Give those back!”

The Imp shook its head, clearly dissatisfied either with Suni’s answer or whatever it saw in the glasses. Then it lightly placed the glasses in its mouth and grinned at Suni with its sharp teeth clenching the fragile device with just enough malice that Suni was scrambling after it before he even considered what a terrible, terrible idea it was.

But what choice did he have? The glasses held the only map of the underground. He might as well give up finding the potion storage unit, but without the map he’d never be able to find his way out either. His only hope was in those clear lenses, and he tried to throttle down his terror as the imp led him pell-mell down dozens of corridors. They splashed through week-old pools, jumped over cracks and ducked under roots. Suni pushed his body hard, wishing for longer legs to catch the damned creature before he became too lost, but the white blur always seemed just out of reach, dangling the glasses like a taunt for Suni to follow.

It took a few minutes before Suni heard the rumble behind him, and suddenly he wasn’t running after the Imp, but from whatever the sound was behind him. Pools rippled with the sound, and an eerie light was growing in the fungus around him. The Imp was going faster, faster, and now there were animals scurrying around them as well - little things dashing up the walls and into cracks, sealing them behind with glue-like droppings. Other creatures were appearing, strange grey frogs with blind eyes that reflected light and newts that shimmered warning colors when Suni ran over their tails. Some roots were moving too, tightening against the walls while others burst open to reveal seeds or pools of tadpoles and minnow eggs.

Suni swore and tried to speed up again, but to no avail. Side passages were starting to close around them, ancient doors rolling shut while others opened, but all were flat and offered no protection against the coming wave. He dimly remembered half an hour of mostly flat terrain before running into the Imp; even had he remembered the way out he’d have had no chance against the water that way.

It was only his exhaustion that saved him in the end. He had slowed at a turn, panting heavily, and chanced to glance up to find the Imp waving its thin tail from behind an open cap. It chittered when it saw him, waved the glasses again, and gestured upward.

The rumble was so close now the slippery rungs of hidden ladder vibrated beneath Suni’s hands, threatening to tip him off every step. He did slip twice, the second time only being saved by the imp’s grasping hands pulling him up and over the lip at the last moment. They didn’t have a second to rest, though, before the Imp shoved him towards the seal-cap. Groaning Suni shoved it back over the top and helped the creature fasten it down.

And not a moment too soon; he felt the water hit as they twisted the last rusty turn; the thrum of it hitting the door hard enough to tumble him backwards. the old metal groaned, rivulets running round the seams and freezing his heart.

But the door held and he collapsed backwards with a sigh.

After a few moments to breath, the Imp appeared above him, glasses held politely between its fingers. Suni didn’t move to take it, and the Imp slid the glasses over his eyes, finishing with a pat to his hair.

Then it skittered out of sight and groaning, Suni sat up.

“I guess I owe you a thank-you.”

The Imp paused its rummaging in their new room and mimed a shrug. Then it tapped its temple and pointed to the glasses.

Suni concentrated on whatever the Imp wanted him to see.

There were a few additions to the map, all in lurid purple sparkles and hastily scrawled imp-faces.

One circle surrounded a time stamp, while an arrow pointed to it from another circle that contained the words “weekly flush cycle" from Roland’s debriefing. Another arrow zig-zagged alongside the route Suni had been following, and Suni could see that there were significantly more upward leading pipes on that route. Elsewhere there were bright “x"s with frowning faces to indicate danger.

Glumly Suni examined the map. He hadn’t realized how near to danger he had been for his entire trip...and he had been half-terrified the whole time. But what was worse was the nagging certainty that was starting to grow.

“Roland would have known that the flush was today. Was he trying to kill me?”

When he looked to the Imp for a response it merely shrugged again and went back to rummaging around the room.

That was all the answer Suni was likely to get, so he took the time to examine the room they had ended up in.

It was definitely a room, not a tunnel or pipe like Suni had been traveling on until then. It was also undeniably the room of a fairy, or at least someone who could fly. shelves seemed to tower around them, two stories tall at least, with no obvious ladders. The Imp was proving this as it prowled around the shelves, clambering up them searching for something in lieu of any other way to get up. Who ever had lived there clearly had an eclectic taste or had used the room as a warehouse, piling dozens of things haphazardly on every shelf with no apparent order,all of them decayed into frayed lumps and dusty piles that the Imp scrambled over with no apparent care for the damage it did.

Though there were the remains of enough technical apparatus that Suni imagined the original owner was some kind of maintenance engineer, what the whole room reminded Suni most of was the Rabbit Hole from Alice in Wonderland, a movie he had watched on repeat as a child. (Dawn found the mad world familiar, while Suni dreamed longingly of a potion that would make him grow big - as big as the towering fairies around him.)

But now he didn’t want to go down. According to the map the imp had modified, there was an exit here, and given the way the imp was rummaging in the shelves, it must have been up one of the walls. Suni stood and went to help, but had no idea what he was looking for, not how to get up the shelves. It seemed disrespectful to whatever past fairy to simply clamber over their things as the imp was, but there didn’t seem to be much other choice.

Unless…

Suni blinked, and found himself looking up at a tea-set. A shift to the left, and there was a comfy chair and a lamp, a good twelve feet off the floor. Elsewhere there were other things he remembered from his childhood story. And hadn’t he heard that many of the early fairies had taken their inspiration from stories they had grown up with? Shakespeare, MacDonald, Wu Cheng’en... It had been a way to connect their changed bodies and strange powers to something they understood. Maybe that was why so many fairies now were obsessed with Fairy-Tales. The stories gave structure to the powers that were far outside their biological bodies.

But if that were the case...Suni squinted into the light at the top of the tower. There might be an exit there, which made perfect sense even without the story. And exit at the top, an exit at the bottom. And…

Suni knelt and looked beneath the shelves, blowing aside dust bunnies and cobwebs. The first two curved shelves yielded nothing, but the third revealed a tiny door. It stayed even when Suni glanced over his glasses, showing just how old this place really was. No illusions here, everything was really designed into the structure. But the fairy had apparently not cracked size-changing, and the latch in the handle caused a quite normal sized door to swing open from behind a set of shelves on the other side of the room.

The Imp, who had been nosing around the join in the shelves, yelped and tumbled to the ground chittering excitedly. When it realized that Suni was the one who found the latch it grinned and dashed over to nudge him towards the door. His own white rabbit, leading him through Wonderland.

“The Potion is this way?”

An excited nod and enthusiastic point, then it clambered up to rest on his shoulder.

“And this won’t end up underwater? Or lead me into a cheshire den or some other monster’s mouth?”

The creature began to shake its head, then paused at the second question and seemed to shrug. Suni paused before ducking through the door. What followed was a minute of Suni asking questions while the Imp mimed its answers and pointed the correct way down the halls.

The halls themselves were completely different from the pipes below, clearly more finished and drilled out with machines rather than grown like the water pipes. Yet the light was still from fungi lamps and the dust gathered in heaps in corners. The rest of the light came from mica reflecting light from the surface down deep into the underground.

“So, there is a monster through here?” Suni glanced down the next turn nervously.

A paw was thrust into his face that mimed a balance tipping back and forth. Then it pointed down a new hall, one that had higher ceilings and looked more finished.

“Something that can be a monster?”

The nod this time was enough to flatten his hair down. Gulping, Suni started down the hall. The door had been cut out of the hard tile that it was built from. The whole corridor was built from it, tiny blue emergency lights winking along the floor. It certainly looked more like an abandoned Fairy facility. A powerful one, if the faded ‘Red-A Clearance’ signs were to be believed.

“Oh...kay. I’m gonna trust you on this. Can you get me past the monster?”

A head shake, and a little finger jabbed the center of Suni’s glasses, wiping a dirty smudge across the purple “x" at the end.

“The monster has the potion.” Suni’s voice was dull, but it still echoed down the new corridor.

He didn't need to feel the nod to confirm his suspicion. There had to be a reason such a facility had been abandoned to the Goblins. Normally Fairies would pull out all tech that could conceivably be dangerous and damage the rest. There was no such destruction here; in fact if he ignored where he'd come from the facility looked akin to the dozens of still-patrolled tunnels he and Dawn had explored as children.

But the signs told a different story. There were hastily scrawled warnings in AR spray paint that his glasses picked up, but the script was so ancient that it had collapsed into gibberish. A mad science experiment could certainly explain all the oddities he observed.

He wasn’t surprised when the imp abandoned him at the round door at the end of the corridor. It clambered down his shoulders, managing to get its foot in Suni’s face twice, then flashed him a double thumbs-up in encouragement before skittering off down the corridor, only stopping to peer back when it reached the door. Suni appreciated everything the creature did, and he didn’t blame it for wanting to avoid any real dangers.

So he squared his shoulders, gulped down his fears, and turned to the glowing blue door, ready as he could be to face what was inside.

Chapter Text

Marianne’s reaction time was all that saved her from being captured.

One moment she was following the roach down the poorly-lit hall, the next moment every light went out with a snap.

Instinctively she performed a maneuver that would have horrified her father, and had Roland berating her back to the barracks for foolhardiness. She curled and snapped her wings around herself, pulling them in - And in, and in - enclosing herself in a bubble of space nearly identical to the ones holding so many captive above her.

The same kind of bubble her mother had confined herself to twenty years ago.

But the motion was familiar, performed often enough to be second-nature. For a moment she was in bubble-space, safe from the world and whatever had destroyed the lights, the next she was clinging to the opposite wall, still invisible, having passed through the darkness unhindered, exactly as she had programmed.

She took a moment to orient herself and strengthen her shields, canceling out far more now than she had with just the roach.

Sound, when it came a moment later, was muffled as if by a pillow, and when -if - light returned it would be seen in faded blues, everything else passing through her.

But for now whoever had cut the lights kept it that way.

“Are you ready?”

Even muffled the voice sent shivers down her spine. A voice like that hadn't been heard in a hundred years. Fairy voices were sweet, elves low, others melodious. This voice sounded like the crack of stone and sparking fire. Nothing modern sounded like that, and Marianne shrunk away, all the warnings of her youth come back to haunt her.

“As ready as I can be, boss" the second voice quavered, coming from much closer to the floor. It gurgled.

“Then get on with it. We don't have much time before they clear the illusion and find the broken lights.”

That was how she had nearly been caught. The interlopers had put up an illusion of a boring, regular corridor, hiding their presence with mundanity. As for the lights...well, Marianne suspected they had good reason for hiding even from themselves and the thought sent shivers down her spine. How close to capture had she come?

“R-right. Here goes.”

There was a brief flicker from the floor, and a woosh of out-rushing air. Until that point Marianne had not realized just how deep the darkness was; but her secondary senses could not penetrate it, leaving her unable to sense what had come out of the bubble or the location of the two speakers.

The small one coughed.

“Steff? It's me, Theo. Now, don't freak out…”

Marianne expected screams from that, as any sensible person would have done upon waking up in darkness and receiving such a line.

Instead, ‘Steff' growled. “Thang, what did you do?”

Marianne could hear the relief in Theo's voice.

“Stuff! Listen, for once this ain't my fault. But we don't have much time. So, uh, positives first: we don't have to pay for your operation any more! The bubble fixed that. It fixed my eyes too! Negatives: my hearing is shit and we’ve been turned into frog monsters.”

There was a dull sound of a slap, and suddenly Marianne wasn't so afraid of the mysterious taller voice, because she had been tempted to face-palm as well. This was the exact opposite of every awakening procedure ever performed.

“Thang…” the big one groaned.

“No, seriously, we look awesome. I’m gonna turn the lights back on so you can see!”

“Don't -”

But the boss’ was too late, and the lights snapped on, and Marianne bit back a scream.

She had known they were goblins, had known of the deformities they had surely suffered, but nothing had prepared her to see the creatures before her. All her books, all her stories, all her promises to herself were just high ideals incapable of withstanding the monsters faces.

First, an almost literal frog, boggle-eyes and mottled green skin, wide lips pulled back from the remnants of a human jaw, shrunk tiny so that he was barely bigger than Suni. Wet skin, hairless with mere holes for ears. Teeth jutting randomly from the lips, crooked and discolored, dulled from what surely had originally been sharp enough to cut scars around the things mouth. Naked body, showing the same splotchy green color all the way down its triangular form, balanced precariously on wiry legs and knobby knees above feet that had webbing between the long, prehensile toes. Had Marianne seen a creature like that after awakening, especially if that creature claimed to be her lover, she would have started running and never stopped.

The Awakened creature was little better; same green skin but smooth, no scales or blotches. She was wide, fat little pot-belly over bandy legs and no breasts to speak of. Her original records - presumably lost for good, thanks to the roach, had Marianne not grabbed the file location - gave her birth name as Stephan “Stuff” Periskopabolis, and showed a picture not unlike the form before her, if seen through a haze of AR filters of the type Fairy children invented to mock their teachers. But there was no cruel virtual world at work here, just hideous reality that had warped the poor woman into a stumpy, ugly monster.

But while logic could lead Marianne to pity Stuff and Thang, fighting down the sheer wrongness of their form, nothing could chill the fear that Marianne felt for the final figure. The...creature towered above her, dwarfing the little goblins and looming over even a pure-breed Martian such as herself. There was nothing soft about him - and it was surely a him, despite no external signs. Hardened bits of something, bark or chitten or some combination of the two, lined his form, parodying armor fairy knights wore, but made out of the goblin’s own flesh, scraped and broken in ways that no knight would ever dare unless meaning intentional insult to his king and court. Feet and hands were closer talons, large enough to wrap handily round her waist and with the clear strength to crush heads if he chose. He sneered out at the world, pale face shadowed by heavy brows of cut bark, matched with chipped, yellowed teeth sharpened to points that shrieked as he ground them down while his subjects spoke. He looked like an ancient tree, twisted and diseased, come to life with the express purpose to warp everything Fairy society had tried to create and turn it to rot and decay.

Marianne had to bite down a shiver when the creature’s piercing blue eyes glanced her direction, hooded eyes seeming to look right through all of her shields. He snarled in her direction, hands clenching on the staff in his hand, seeming about to strike out...when a sudden trilling sound came from his hip. Marianne started, nearly losing her grip on the stone, when a flickering red alarm-bug crawled from a pocket on the monster's belt into his hand, its wings giving out a high pitched whine. The bug was so normal, something children still set to guard their playhouses, as to shock her from her fear...even as it shocked the man into action.

“Cut the chit-chat, Thang. We need to move.”

“Oh! Yessir, Mr. King, sir.” The frog mimed a salute that seemed to be serious, despite the imperfect execution, and grabbed Stuff’s paw without a second thought, despite her three-fingered hand being dwarfed by his webbed grip. “This way, honey. We’d have brought you out closer to home, but we’re going under the crystal field, and even us Goblins worry about that. Oh, yeah, that’s what we’re called, by the way. Goblins.”

And, against all logic, Stuff grinned. “Goblins? Sound’s about right. World ain’t that different now, is it?”

-------

Suni stood before a round blue door and debated his life decisions. Behind him, the Imp was probably long gone after giving out its dire warning about the monster behind the door. He now had a safe map back to the surface, helpfully annotated by the little creature, and since no one but Roland knew he was down here, there was no shame in simply turning back now. It wasn’t as if he could fall much lower in Roland’s eyes, after all.

But Dawn would be so happy if her mother returned. The thought of her smile was enough to push Suni forward, seriously examining the door, quashing the fear down as best he could.

And maybe he couldn’t get in after all. There was no reason that a secure government facility would let an elf in, right?

He brushed aside the dire warnings flashing over the door lock, both physical paper and dozens of patchy AR explanations that were unfortunately made unreadable by time. It was clear how old this part of the facility was just from the locks; old school biometrics, rather than the simple mind-scanners that fairies now used. Not nearly as secure, either, given how modern locks depended upon one’s individual connection to the net, impossible to fake unless one could replicate the brain down to the smallest neural connection, what fairies called a Soul Lock. Biometrics were paltry in comparison. All this one required was a hand print, pressed onto a blue glass panel beside the round door.

But Suni only knew the basics of real-world hacking, and the lock stumped him. Back in the castle, there were plenty of places he had needed to break into - housekeepers and butlers being the ones everyone called when locking the metaphorical keys in the car - and most required getting the victim to remember the state of mind they had been in when creating the lock...or simple brute forcing it when the fairies forgot that no matter how ‘locked' the door looked in AR, one could just walk through most screens. This lock - and definitely this door - were far more formidable.

Still, there was no harm in trying...right?

He placed his hand over the scanner, thinking of all the stories where this actually worked, and prayed that the warnings hadn’t been followed up with traps for anyone trying to open the door.

“Human Hand-print Verified. Continuing to DNA analysis. Confirmed.”

The computerized voice read out, and the blue lock flashed green. Suni gulped, drawing his hand back and hoping for the best.

“Enter the Recovery Room at your leisure, Suni Dai.”

Before him the door irised open, revealing...nothing.

Suni blinked, and then blinked again. Through the door was a white-tiled room, just like the corridor behind him, lit with blue lights, but completely empty but for the traces of a blue haze of uncirculated air. Within his glasses was no different, except perhaps the fog being thicker, but that could have been a trick of the light. Not obvious monster, no violent trap, no hoard of mechanical guards ready to eviscerate him…

Slowly, he inched into the room, comforted by the fact that the door didn't close behind him. Even when he was fully inside the room, there was no change beyond the lights brightening slightly.

“State your query.” The dull feminine voice of the computer continued.

“Uh…” Still no change. Suni was beginning to get a tad irritated. “I’m looking for a potion?”

“It has been 435 da- d- d- d-" The voice stuttered, then suddenly screamed - “Don’t you even know why I’m in here? Why would you ASK for that?”

Suni yelped and clapped his hand over his glasses speakers, causing the glasses to rise up so he saw the blue face screaming at him from the AR smoke.

“AAAAAAH!” He stumbled backwards out of the room.

The face screamed back “AAAAAH!” Then resolved itself into the ghostly form of a woman, pulling herself from the haze. Lights flickered in the room, reflecting a form on the fog, and the virtual woman took shape in the real world as well.

“AAAAAAIIIIIIII - It has been four hundred days since...” The woman’s mouth moved from scream to monotone movements completely at odds with her startled then peeved expression. She rolled her eyes above her still moving mouth, and interrupted herself “last we - Yes, yes, I know that. Now, who do we have here?”

Her face loomed large, the lights in the mist coming to rest over Suni as she examined him.

“Ah, I see. A Human. No wonder. Bog must not have caught you yet.”

The form pulled back, and settled into a seating position, floating.

“Well, what do you want, human?”

“Wh- wh- wh-”

She rolled her eyes again, and mimed a continuing motion. “Hurry up, before he comes.”

“What are you?!”

-------------------

Marianne didn’t follow the goblins back to their ‘home'. There was no need, really. The fairy military had a good idea of the location of the goblin’s main base, deep in one of the old subterranean cities, through a maze of un-monitored tunnels. While intel on how to navigate those tunnels would be useful, the danger was too great for the heir of all of Mars to go haring off into ‘enemy' territory. Anyways, she had already spend too much time out of contact range.

So she returned to the surface, deeply unsettled. She hated to admit it, but the goblins had frightened her, badly. It was easy to pretend to sympathy when no one ever saw the creatures anymore, far more difficult with the race of adrenaline in her system telling her that there was something wrong, wrong, Wrong! about the forms before her.

Genetic fear. The same thing that caused ELFs to jump at snakes and hesitate before entering deep water, no matter what their technological or bubble-gifted powers. Fairies were supposedly beyond them, but Marianne had never encountered anything that was truly a threat to her.

What kind of warrior was she, then, if her reaction to real danger was to freeze?

And could she really say she was hurrying from the underground because she might need a ‘net connection...or because she was scared of what was behind her?

She slowed to a slower glide, wondering if perhaps Roland did have a point when he said she was too inexperienced to lead the armies of Mars. And if that was true...perhaps she should not have dismissed the calls for the end to the Goblins so quickly. Some, like Roland, had fought the creatures. They had experience. Had she any right to declare their convictions wrong, when she couldn’t even hold true to her ideals when encountering a hint of danger?

Of course, the moment she exited the underground, Roland himself was there to remind her of that very thing, appearing in her peripherals to berate her for endangering herself and worrying her father and sister.

“Really, Marianne. A whole half-hour, gone! I was on my way over immediately. Imagine what could have happened to you outside my reach!”

“Roland, nothing happened. I just was examining the Repository security system from the tunnels.”

“That’s what we have elves for, dear. They can go into danger, you need to stay on the surface, where people can see your beautiful face. Now, wait right where you are so I can make sure nothing untoward followed you back up.”

As he spoke, Marianne’s fear of the goblins began to wear off, replaced with her typical resigned fury at Roland.

“I am capable of my own security check, Roland.”

“Of course you are buttercup, but why don’t you let me - or one of the technicians - check to make sure.”

“Get out of my systems, Roland.”

“Sweetheart - “

“Now, Roland. That is a direct order from your superior officer.”

Authority only seemed to have any effect on Roland if it was male but approaching the exit of the bubble repository, and a tech hurrying towards her, gave her enough of an excuse to hard eject him from her system.

She was prepared to harshly chastise the fairy technician for the disarray she had found deep in the catacombs, and then interrogate them on the lax security she had found, but by the time the fairy arrived her curiosity had won out, and once again she put off simply fixing the problem and opted to discover the reasons for it.

“Princess. You disappeared for - “

“Thirty minutes, yes. I was looking at the tunnels.”

A panicked expression flashed across the fairy’s face, replaced just as fast with cool composure and a question - “Did you find anything?”

“No, not anything out of the ordinary.” She said carefully, watching the tech’s reaction just as carefully.

The relief was restricted to the tech's eyes, but was there nonetheless. Marianne added the woman - Diane, according to her file - to the her dossier of people to investigate. Could there be someone feeding goblins new recruits...And if so, was it simply to free more of those bubbled, or for some more nefarious purpose?

“I knew you could take care of yourself down there.” Diane said. “But protocol said…”

“You did the right thing, notifying my security detail.” Marianne said, ignoring the guilty look on the woman's face indicating she had done nothing of the sort - nor should she have to, were it not for Roland's ludicrously tight security on the princesses.

“You had calls while you were on patrol…”

“Roland?” Was he hounding the techs now, too? Marianne wouldn't put it past him.

“No, he says he'll always call you directly.” True, but infuriating, given Marianne’s standard order to route her messages through the security desk while she was on patrol, just like every other guard. But Roland thought he was above such rules, and claimed that there was no point to power unless one took advantage of it -at least, he said so in his diary. “Your father wishes to remind you about the preparations for tomorrow's ball.”

All thoughts of goblins and conspiracies fled her head, and Marianne swore. “He still wants my help?”

-------

The apparition before Suni blinked, then reused her favorite stock expression - rolling her eyes. On her face it looked creepily similar to that of an emoticon or gif; movements repeated in the exact same way as they had before, without the slightest bit of normal human variation.

“What, no introductions first? Right to the ‘what horrible abomination of science are you’ bit?”

“S-sorry. I’m Suni Dai, ELF of Mars.” Years of training came to his aid, and he bowed extra deeply, unsure of where this apparition fit into the social order, but not wanting to offer any further insult.

Apparently it worked, for the apparition preened. “Very well. I am The Sugar Plum Fairy.” Suni didn’t even have time to react to that announcement, before she continued with, “ And I am the governing computer system of Mars.”

Suni stared at her, whiplash from two extremely unlikely statements handly freezing his brain.

“Ah, yes, awe. That is the appropriate response. I’m sure your request seems a bit silly now, doesn’t it? Begging the very mind of Mars itself for an audience?” The self-named Sugar Plum Fairy smiled haughtily and sat back into her blue cloud.

“That’s not - “ Suni tried to start a sentence, stopped, and started again. “Mars’s net is not sentient.”

Sugar Plum snorted. “Well, not anymore. Not since they trapped me here 700 years ago. Now no one comes and visits me unless they need to override the system. Which is why you’re here, I assume?”

“How - “

The form in the mist swirled and suddenly Suni was looking at himself, expression perplexed and saying, in a trembling voice “I’m looking for a potion?”

She returned to her standard blue form. “See? You want a potion. Given the way my Unconscious reacted, you must be wanting a Dissolving code. Or as I like to call it, a ~loooove~ potion.”

“How’d you know - “

She rolled her eyes again. “Because that’s all anyone ever uses it for. At least, if someone travels here through the tunnels, sneaks past the Bog’s guards and over-rides the anti-Fay locks. Nothing else but ~love~ could motivate one so.” She smiled gleefully. “You humans are ~so~ romantic.”

Suni rubbed the back of his neck. “Well, I guess. But it's not just that! It's for a noble cause! I want to wake the Queen. It’ll help all of Mars, and give the ELFs some hope, and bring Light to even the darkest - “

“Blah, blah, no not doing it.”

“What? But - “

“To reiterate - “ The AI split herself in two and the second screamed “Don’t you know why I’m in here?”

“The Love Potion?” Suni guessed.

“Exactly. I used to have all sorts of friends, and then just because of a little mistake I was trapped here, locked away from all the fairies and with only goblins for company. And your ‘Queen' was the one to blame! But I still did my best to help, giving out my potion-codes to all the friends I had left...and what happens? The Goblin King went and cut all his Goblins off from me too! Now…” She paused, and for the first time a genuine look of regret, rather than a pantomime emotion, crossed her face. “Now only an unmodified human like yourself can visit me. Why should I risk even that for someone like that stupid Queen and her damn rodent? There’s no logical reason for it!”

Privately, Suni thought that there was very little logic at all to the AI. It was clear that she had been locked away because she had gone mad. But that did mean she could be swayed in other ways. Take her name, for example. Apparently the Alice Goblin wasn’t the only one obsessed with stories...

“Okay, okay. I understand why you don’t want to help the Queen, or all the people that put you away.”

“Exactly! If they’re having problems, it's their own fault!” The AI turned her head away and crossed her arms.

“But Dawn wasn’t even born then. And she hasn’t done anything wrong. And I really do love her, but we can never be together, ‘cus I’m an ELF and she’s a fairy…” The AI’s expression twitched, and Suni knew he had her. Circuits and Networks might run on cold logic, but minds ran on emotions. And if Sugar Plum was cut off from her network, it stood to reason her logic circuits were cut off as well. “But if I did something amazing for her, be a hero, save the world, then I’d be worthy, and no one could keep us apart. We’d get our happy ending.”

The AI screwed up her face, her inner conflict conveyed by two arguing mini-plum icons on either side of her. But the battle was quickly won, and she sighed dramatically. “Fine! You get the potion, so you can get the girl.” She stood, and snapped her fingers. “Just wait a moment, and I’ll make it for you.”

Around her the room began to hum, servers hidden behind the walls awoken from a decade of slumber. The mist that the AI floated in churned with the new air-flow, and Plum flickered, her form refracting into little reflections as the lights tried to track the wind, the tricks of perspective used to make her appear three dimensional breaking down as the fog writhed.

“You’re lucky. I’ve been decanting this stuff for years. Mr. All-mighty Bog King forgot to tell me to stop, so the base is po-oh-tent!” A wave of her hand, and a panel opened up from one wall and extruded a flask filled with a glowing blue liquid.

Plum caressed it, wrapping code into the physical liquid, making it shimmer beneath her touch until it became more than just a physical object...or one that only existed in the virtual world.

“Bubbles are strong - strong as the mind that makes them, impenetrable even from my reach if self-made, and doubly protected by that slave my system became.” She drew close, and appeared to breath on the bottle, her breath coming out as a fog of numbers that seeped into it. “But I’ll just tell myself to look elsewhere for a bit, and the field-dissolving agent will do the rest. But be careful - I haven’t had much to do these last five years but crunch numbers, so the potion should be strong enough for multiple uses. Bring the Queen back if you wish to win the princess’s favor, but do not let it get into the hands of that damnable Imp she keeps as a pet.”

“An Imp?”

The AI glanced up from her work, grimacing. “Yes, an Imp. She sends - well, sent, if she's gone and bubbled herself - it down into the caverns to communicate with the Goblins. And it loves to steal my potions and wreck havoc. Unless you want every ELF it finds un-bubbled, then you’d best keep that potion to yourself.”

So that’s why the Imp knew where Plum was, Suni thought to himself, while nodding in agreement to the AI’s statement. “No imps. Got it.”

“Good. It's done. Instructions are as follows: “ As Plum spoke, her personality leached from her voice, back to the dull monotony of a normal AI. “Cover your intended target fully in the field liquid. Wait until the indicator for a full seal appears. Step back. The process should take less than six seconds. Be careful of any - Oh! I nearly forgot!”

The bottle halted on its trip towards Suni, the conveyor that held it jerking it backwards into the fog, almost as if Plum was a physical entity grabbing it back. Her fog swirled around it, and her lights flared as she planted a bright kiss on the bottle. In the physical world, the conveyor then began moving again, but in AR, Plum stretched out her arm to hand it to Suni.

“There! That will get you through any of my pesky security systems. Now pull.”

Confused, Suni took the offered bottle and pulled it off of the conveyor and subsequently out of the room.

Had he been looking through his glasses, he would have seen the gleam in Plum’s eyes and the ways her hands clutched at the device, seen the way her code writhed round the frame, grasping and pulsing with blue light. Instead, he just saw the bottle trailing a few extra cords, which pulled from the wall with Plum’s instructions.

The instant the cord - not the bottle - left the room, every light in the whole facility turned red. Suni nearly dropped the bottle as an alarm began to sound, and from somewhere he heard the sound of pounding feet.

“Damn!” Plum complained in his ear, and he turned to find her mist trapped behind a translucent barrier, pounding ineffectual at it with virtual hands. “I’m still trapped!”

The mist boiled around the point the cable had left the room, the barrier shooting angry red arrows at the breach. Plum slammed her hand against it one last time, then looked out from her cage, where Suni still stood, confused.

“Nevermind, me. Suni! Run! He’ll be coming soon!”

The wrapped cord dropped from the bottle, and Suni followed the AI’s directions. He ran.

-------

Moments later, warping in with a swirl of power, and the Bog King arrived, followed shortly by half a dozen goblins running from the security checkpoint, only to find Plum sitting primly from within her fog.

“What did you do, witch?” The huge goblin demanded.

The AI shrugged. “Someone came to me for help. I gave them what they wanted.”

The King’s eyes narrowed. “And they helped you try to escape?”

Plum at least had the dignity to look a bit guilty. “Well, no. I might have tricked them a bit with that. But he’ll be happy with the result, I’m sure!”

“Guards! Search the tunnels for the thief!” The king roared. “Don’t let him get away! As for you…”

The fog drew further from the doorway. “What are you going to do? You need me!”

The king sneered. “That I do. So I’m not going to go erasing all your data, much as I’d like to. So instead…” He smiled, red light glinting off of his mismatched teeth. “You are going to tell me everything about this thief, and what you’ve done.”

Plum crossed her arms, attempting to look defiant while still pulling her code as far away from the door as possible. “You can’t make me.”

“Oh, I think I can. Computer, repress the P.L.U.M. executive function.”

“What? No!” From the walls, silver chains snapped out, etched with the words the goblin had just spoken, visualizations of the command lines he’d uttered.

“Playback output log from this device.”

Within the room, the chains bound around the AIs form, dragging her back to the foreground, kicking and silently screaming, but unable to resist. Her voice, when it spoke again, took on the cadence of monotone.

“From what time do you - No! You - wish to view?”

“What time is the PLUM program trying to hide?”

Helplessly Plum watched as a duplicate of her appeared, a perfect replica of the moment Suni had activated her program, sleepy eyes widening in surprise, mouth frozen in the form of a shout, while her own mouth said -

“Playback beginning thirty minutes ago.”

Chapter Text

The worst part of being a princess, in Marianne’s opinion, was the social functions. She had forced herself to attend them with Roland, wearing a pretty smile while he showered her with compliments and showed her off to the crowd, which now she knew was all just a ploy to make it harder for her to break away. Now the press of people, the pressure to perform, the fear of making a fool of herself, all of that was too much to bear. As a child she remembered her mother being radiant on solstice days, perfect in a way that Marianne herself had never been able to replicate, but exhausted the day after.

As future Queen, Marianne could not avoid every social function, no matter how much they grated on her nerves. But she had found that the more she helped with the preparation, the faster she could excuse herself from the actual function. It helped that Dawn actually enjoyed parties, enjoyed being out in front of the public, and was happy to take most of the social responsibilities of leadership. And that while her sister was in the grips of creative frenzy no one was allowed to bother either of them.

“What do you think, Mari? Pink or Fuschia?”

Marianne pulled herself from her brooding, to look at the new coat of color on the AR displays. The two Princesses were in one of the cavernous half-rooms on the edge of the palace, half of which was overhung with a cave ceiling complete with stalactite chandeliers, the other half open to the evening air. The real room was shaded in colors of blue and green, reflected from the large fountain in the center of the paved area. Against the soothing natural backdrop, the pink clashed with just about everything and gave Marianne a headache.

“They both look fine, Dawn.”

“You’re right, neon would be better.”

Left to herself Dawn changed the colors with a wave of her hand, not miffed in the slightest that Marianne was clearly thinking of something else. Marianne’s many talents did not include party planning, and there was nothing wrong with that. If their father simply turned over all such things to Dawn everything would go so much smoother.

This party, for example, would look quite well with green coloring. Virtual bunting unrolled from the ceiling at a wave, matched by the lights glowing from between the stones of the floor. Weaving together the virtual and real, so that one could enjoy both or either one alone, was one of Dawn’s specialties. Marianne spent too much time in the real world to but such effort in.

The younger princess glanced at her sister, worrying at her lip. It was easy to see why Dadga had insisted Marianne help, though. After the Roland fiasco, Marianne had withdrawn, and now the only thing that prevented her from retreating completely into the military was the demands from her father and sister.

With a flick, matching beige tables appeared in the virtual world, to be replaced with real tables later, and Dawn ran a simulation of traffic flow, suddenly surrounding the two of them with hundreds of chattering fairies. Marianne didn’t even flinch, confirming that she was only occasionally glancing in at Dawn’s work. It was a compliment, in some ways, the confidence Marianne had in her younger sister, even as a line formed at the buffet tables and Dawn flushed scarlet at such a faux pas and quickly rewrote the servants’ routes.

It worried the young princess, and as the world flickered around her, changing faster than a child could upend a doll-house, Dawn wondered what Roland could have done to make her sister withdraw so much. They had known the man all their lives, and he had always been a perfect hero, the knight on the shining white horse from all the story-books. A young Dawn had even been jealous of her sister for apparently catching the knight’s fancy, until she realized that the most powerful woman and the most handsome man were surely made for each other.

“Dawn!” Marianne swore, and Dawn realized that she had pulled out the wedding decor on instinct. Pale greens matching Roland’s armor and smoky reds to represent Mars surrounded them, making Marianne’s purple wings stand starkly out of place.

“Sorry! Let me just - “ The colors reverted to blues and teals, and the tables settled back onto the virtual ground, from where they had floated up for the wedding set. Marianne’s wedding had been planned for Spring as well - a spring a full Martain year ago. It had been one of Dawn’s best showings, full of light and color and joy. But now, looking at Marianne amidst the fading finery, Dawn realized just how out of place Marianne would have looked within it. Oh, everything had matched Roland just fine, but Marianne looked like the one spot of darkness in all the light, with her dark hair and darker wings.

“It's fine, Dawn. Just a surprise, that’s all. I really would have looked stupid in this, wouldn’t I?”

The younger sister remained silent, thinking of how much effort Marianne had put into the wedding, though Roland had helped most with decorating and boastful planning. It was probably the last party she had tried to help with at all.

“You would have looked lovely.” She finally said, pulling back the image and placing a virtual dress over Marianne’s guard uniform.

Her sister laughed. “Look at me, Dawn. All this color and light? I look just like a…” She paused, blinking. “...like a Goblin.”

“Oh, but that’s for the old you!” Dawn quickly insisted. “I redesigned everything for the new you!”

With a dramatic flourish she brought forth her current pet project, a ball she had mentally set for the fall equinox. The tables flew again, this time colored in deep blue with flickering stars caught in the threads. Around them fairies and elves waltzed, elves wearing winged shoes to bring them to the level of the fairy dancers. Every color of wing surrounded them, but none clashed with the dark, yet warm colors. Firelight flickered off of the walls, and the chandeliers had become stalactites with mellow fireflies giving off their light. The fountain was replaced with a stream running across the whole floor, and the lights beneath them were red and gold while the walls were dark burgundy.

And Marianne’s dress was slim and form-fitting, not a frothy concoction of nothing, greek inspired with her sword prominently displayed. It matched her wings, with the deep darkness of space dotted with a purple galaxy. It fit over her leggings and boots, and showed off her wings and shoulders without restricting either.

Marianne looked critically at Dawn’s handiwork, far more detailed than the plans she had constructed for the current party, and the younger princess felt her heart rise in her throat.

“...It's beautiful, Dawn.” And she smiled down at the virtual fabric, running her hand over the piece Dawn had coded each individual star into. And she smiled, a little sadly, true, but it was a smile. “If I ever get married, I’d wear this dress.”

Her head shot up, and she interrupted before Dawn could squee - “But I’m never getting married, hear? Never! Love is pointless and a lie and … “

Dawn sighed, “Yes, yes. Good only for propagating the species, I’ve heard you say it a million times. But you’re coming to my wedding, right? When I meet my one true love, and he sweeps me off my feet on his giant dragon, and - “

“Alright, no, no, no! Where are those plans? Here! Let's get back to work!” And things went back to normal, at least for a bit.

----------

Suni had been careful to follow the imp’s map to the letter. There were times when he heard voices around him, the sound of running feet and barked orders, but each time it happened there was an opening he could dart into and hide. The bottle in his hands was cool, and the glow of the liquid had died down, dormant until it was used, and so the shine didn’t give him away, even as he crouched, shivering, while ponderous forms moved past. Surely goblins had trackers, right? - He asked himself, but the flood had left pools and rivulets everywhere, and as he splashed through them his scent was lost. His dark form and worn clothing let him blend into the surroundings, and perhaps the goblins did not know the tunnels as well as they thought they did, for it seemed that in barely any time at all - and only five near-death experiences - Suni found himself in front of a door he recognized.

It was the entrance Roland had shown him to.

It was a tiny door, deep beneath the Palace, heavily shielded with AR filters but in truth a simple wickerwork thing, twined through with grapevine. Certainly not something capable of holding back the flood waters Suni had experienced, but he had left the deep tunnels three stories below. Here damaged snufflers patrolled, shoved behind the door by kind hearted ELFs who couldn't bear to recycle their inefficient tools. One such creature was even now patrolling by the door, its nose pressed to the floor and mounds of dust piled high outside of the two foot circle its programming trapped it in.

Suni turned away from the mournful sight and jimmied open the door, already thinking of how to tell Dawn about his discovery. Would she be pleased? Would she be angry? Would she have even noticed he had been gone?

----------

Elsewhere, Roland received a notification of Suni’s return, and nearly spat hot tea across his manicurist’s blond curls.

“He survived?!” He swore, shoving the girl away, not bothering to turn off her AR sim.

He flicked half-dried nails off and paced, rewriting all his plans for the day. He had hoped to be delivering Dawn an obituary in a few hours. Barring any proof of death, he had hoped to insinuate that Suni had run off with the metaphorical silver, though finding anything that the second princess valued enough to mind losing had been more difficult than expected. At the very least, he had hoped to prove Suni’s incompetence while he was gone for a few hours, but the damn ELF had scheduled Dawn’s day so well that the princess hadn’t needed any of his services. And he had done all that preparation beneath Roland’s nose, while listening politely to the supposed plan, a fact that Roland hadn’t even noticed until the boy had been in the sewers for twenty minutes and Roland’s cronies had messaged to say that their plans for disrupting the princess had been foiled by a non-existent ghost. A new dress had been waiting for her the moment the first one ripped, and everyone had admired the amazing detail that had gone into the AR shield that covered her the instant Tony had 'accidentally' tripped over her. The damn ELF had apparently backup protocol for every conceivable accident.

So, at the end of the day, Dawn was still the sweet, kind girl she always was, no more or less impervious to outer influence, and all the political favors Roland had arranged in return for making the ELF disappear would evaporate like so much smoke. The only good thing that could come from it would be berating the boy for his cowardice in not going deeper into the depths.

Roland huffed and told himself to be satisfied with it. Certainly this was not the first setback in his quest to be king, nor would it be the last. He readied his perfect glamor and hurried out to waylay Suni before he reached Dawn.

Behind him, still trapped in her AR dream, his ELF manicurists replayed the motions of painting his nails, drops of shimmering polish dripping from a tightly controlled brush, the girl flinching from a punishing shock each time one hit the floor, though she could no more alter her movements than she could see into reality and understand her mistake.

But this was hardly the first time Roland had left her as such. By now, she accepted it as her due.

-------------------------------

“Suni! I thought I told you to get the Potion, not endanger the whole court by haring about the underground!”

Roland’s voice boomed and Suni flinched, despite not a single other person in the vicinity, ELF or fairy, being able to hear Roland’s directed shout.

He had been trying to get to the princess’s suit to show her the potion and to make sure her schedule had not been thrown into too much disarray by his absence. Luckily she had been scheduled for festival preparation along with her sister. One of the positives of the elder princess was her straight-forward nature that prevented Dawn from becoming too distracted. Another positive was how everyone stayed away on days that the Crown Princess was forced to plan events. Dawn might be safe from the sudden, inexplicable violent outbursts, but no one else was. Suitors and petitioners alike would stay far away from the two sisters for most of the day, making Suni's job much, much easier.

Still, being halted before he got to show off his prize was a disappointment. Of course Roland would try to steal the glory; nevermind that Suni did all the work, as a Fairy Roland outranked him and could take what he pleased.

But at least Suni would get something from it all. He squared his shoulders and drew himself up to his full, diminutive height.

“I did exactly as you asked, sir.”

“Nonsense! I asked you to - “ And Roland stopped, eyes falling upon the glowing bottle in Suni’s hands. For the first time in the years upon years Suni had known him, Roland was speechless.

Then he grabbed the ELF by the collar and whisked them into an alcove, well screened from all but the lowest servants.

“Is that…” He began.

“A Bubble Dissolving Potion.” Suni displayed his work proudly, the glow lighting the whole alcove with artificial purple. “Straight from Sugar Plum herself.”

Roland whistled and reached out. “I must admit, you’ve impressed me, Sonny.”

“I’m…”

But then Roland’s hand clasped the bottle, and the world screamed.

Gone was the purple glow. Gone were the cheerful sparkles. The whole bottle turned red and a blue head exploded from its contents.

“THIEF! THIEF! THIEF!” Sugar Plum shouted, and both Suni and Roland clapped their hands over their ears.

“You triggered something!” Roland shouted over the noise, trying to shove the bottle into a side bag.

“I didn’t…”

“ROLAND. I KNOW IT’S YOU. GET YOUR HANDS OFF MY POTION!”

Roland gulped and dropped the potion to the floor. Only then did the alarm shut off. It did not return when Suni cautiously poked then picked up the bottle a minute later.

He looked up to find the Fairy red-faced in a moment of anger, then watched as an AR mask snapped over it. Suni, glancing over his glasses, saw as Roland’s real face contorted as he forced his composure back down until his voice was level enough to speak.

“That witch.” Roland finally said when his face was back to a healthy shade.

“I take it you, uh, know her?”

Roland’s true smile managed to match his illusory one except in the eyes. “She has me confused with someone else. Her memory must have been scrambled when they captured her.”

Suni blinked. “But how did you…”

“Nevermind that.” Roland smoothly interrupted. “Now that you have the potion, we need to plan what to do with it.”

“Give it to the Royal Family, of course. Sugar Plum said it was dangerous, and they’re the only ones who…”

Roland’s eye twitched and he launched himself forward to clap the ELF on the shoulders. “Sonny, Sonny, Sonny. This is why you’re just a servant. You need to think of the bigger picture. You need to plan with this.”

“But…”

“No. You leave this to me. We are going to keep this a secret. We’re bringing back the Heart of Mars, man! No one cares how we do it, as long as it looks good. There needs to be ceremony. There needs to be spectacle.” He grinned and declared. “We’ll bring the Queen back tomorrow, during the King’s speech.”

“What?” Suni sputtered. “No way. We don’t know anything about how the Queen went into the bubble. She could be sick. She could be crazy. She’ll need Awakening technicians. The last thing she needs is to come out in an auditorium full of people.”

“Sonny, this isn’t about the Queen, it’s about making her daughters happy.”

But Suni prattled on, his life as an assistant conjuring up millions of horrible scenarios. “What if she went into the bubble naked? Or with an armed weapon? The royal family sits below the dais; she won’t be able to see them when she comes out, and might assume the worst. Or she could be disoriented and fall. Oh god, we might kill the Queen! And - “

“SUNI.” Roland shouted at him. “I will deal with everything. You just need to get to the bubble during the ceremony. I’ll take the stage and deal with everything else.”

“But…”

“No buts. Just think about your goal, Sonny my man. This time tomorrow Dawn will be yours.”

And, allowing no further argument, Roland swept out of the alcove, plans already whirling in his head, finally, finally his goal within reach.

Behind him, a last but died on Suni’s lips and he tried to do as Roland said and stop worrying. It wasn’t as if he had any choice, anyways. Already an ugly red virus pulsed in the corner of his glasses, certain to release something dire should Suni disobey his orders. Roland wanted him to do something, and he couldn’t really say no.

------------------------------

Chapter Text

“Suni!” Dawn shouted.

The ELF had finally tracked his mistress to the kitchens, where she and her sister were deciding upon the menu for the festival. Dawn was wearing her favorite blue sundress, and Marianne was wearing a sour expression. They sat before a pristine, white bank of monitors, while beneath them the entire kitchen spread out for acres.

The whole thing was underground to best service the castle, but natural light was reflected in, making the whole area gleam with a warm, welcoming efficiency. In the distance plots of herbs grew, each a chef’s personal garden, and blue elevators brought the workers directly up to the farms, where they could choose the freshest produce for the royal table. Elsewhere there were darkened rooms, or areas with artificial temperatures and humidity, all in service of making dishes unique to Earth environments. At some stations bubbling concoctions brewed in ancient cast-iron cauldrons while a few rows down ELFs used modern machines to create flavors no Earthling could ever recognize. The whole area hummed with the buzz of invention in equal parts to mastery of age-old classics.

But the princesses were not interested in the bustling spectacle before them. Instead they were focused on the sample plates that the head chef had prepared. Hundreds of thin slips of plastic were set out before them, each printed from the white flavor banks, each recording the flavor of a specific dish as created by the chefs currently working in the Royal kitchens. Other, less easily accessible, computers stored the flavors and recipes of every chef that had ever worked in the palace and more beyond. From all of these the festival courses would be selected, carefully choosing the correct combinations to bring the culinary experience to its very height, no matter the order the dishes were consumed or the background of prospective diners. And, because Dawn was a professional, the flavors would match the theme and colors of the spring festival, and offer something new to every guest. But to do so, she used every tool at her disposal, and she did indeed have a great tool.

Dawn had, at her fingertips, the entire culinary history of Mars.

“You came just in time!” She held out two identical looking tabs. “Which tastes better?”

“Dawn, you know I have retrograde genes…”

“That’s exactly why you are perfect! I wouldn’t want to disgust a dignitary simply because I can’t taste bitter. C’mon! Try it!”

Suni placed the tabs on his tongue, one after the other. “They’re both fine. The second is a bit bitter, but it adds to the flavor, rather than detracts.”

Dawn beamed, while Marianne handed him another tab, stony faced, clearly having been subject to Dawn’s taste-testing for far longer than she could stand. Suni obligingly took it.

The instant he placed it on his tongue he spat it out, swearing. “Marianne!”

The elder princess cracked a smile. “The look on your face!”

Dawn echoed Suni’s complaint. “Marianne! That was mean! Even I could tell that recipe had PTC in it! It said so in the report!”

Marianne raised her hands in apology, grinning, then ducked from something immaterial. Suni wasn’t surprised when he glanced into his glasses and saw a caricature of Dawn pelting her sister with glowering broccoli. Marianne laughed as she battled off the onslaught with waving hands and an imagined vegetable knife. Even the ELF attendant hid a smile at the two princesses’ antics.

“Mercy!” Marianne finally begged, having been covered head to toe in illusory tomatoes.

“Only if you apologize to Suni!”

Suni gulped and caught the thin lipped glare from the attendant. Princesses did not apologize to ELFs. “Dawn that isn't…”

“No, she’s right.” Marianne said, brushing beautifully rendered tomato paste from her face. “ What kind of Queen would I be if I couldn't admit to my faults?” She grinned ruefully. “I'm sorry, Suni. I shouldn't have pranked you.”

“Much better.” Dawn declared, ignoring the look of shock from the ELF chef. Suni knew the ELF must be new to the kitchens, or at least had never met the Princesses. For all the rumors of their eccentricities, it was another thing to see them in action. The idea that a princess - the future Queen - would consider such a lowly ELF like Suni worth apologizing to was rocking the woman's world view.

“Now where have you been today?” Dawn continued. Suni flushed at the idea that she had noticed his absence. “ I haven't seen you for hours.”

He opened his mouth to reply, thoughtlessly about to answer the truth, when an alarm sounded in his ear and the virus burst open.

Suddenly his vision was red. Gone was the pleasant kitchen, gone was the clean bank of monitors and the busy scramble of activity. Somewhere, behind him, a piercing shriek began coming ever closer while the faces of his friends began to contort, black ichor dripping from their eyes. And on the table...on the table...

The two princesses (and one confused chef) watched as the color drained from his face. One minute he was the polite, bashful Suni they knew, the next he was shaking, eyes wide and staring into nothing. Tears prickled at the corners of his eyes and his dark face turned an ugly grey. Sweat dampened his shirt and he stood like a stone, eyes not even twitching as he was pulled further into the AR nightmare.

Marianne swore, but Dawn was faster, jerking forward and tearing the glasses from his face.

Only then did he collapse to the floor, gasping. Dawn glanced into the glasses, then dropped them as if they had turned into a sewage-bug, disgust and anger growing on her face in equal measures. She saw enough to know that someone had made the AR nightmare just for Suni.

“Who did this to you?” She demanded, but Suni was mute, tears leaking from his eyes, and all he did was grasp her hand tightly.

Marianne didn’t need to ask, but she grabbed the glasses anyways. With clinical detachment she observed the severed head of one of Suni’s many sisters, the rest of the body ripped apart and leaking blood on the floor. Insects only a ELF would recognize crawled over the table, and she deftly placed her hand over the speakers to silence the high-pitched whine designed to make the whole experience more hellish.

“Roland.” She hissed, not bothering to play nice as she ripped the virus from Suni’s system. Everything was external for the ELF, so he was not subjected to the searing headache that another would have received had she been so violent. Any damage to the software she caused would grow back quickly: Suni’s system might be external, but it was still the best the royal family had. That was all that saved him from the worst of the subroutines Marianne could see worked into the virus’s code. A normal ELF would have smelled all the scents to go along with observing a family member’s decaying corpse, and the horrific shrieking was only one of a dozen of terrifying sounds meant to make living with the virus hell.

There were not many who could create such a perfect scenario. Dawn was one of them, but she would never create something so cruel. But Roland...there was a reason he was a high-ranking member of the military. He had a genius for illusions, complete mastery and control of every AR system Mars had to offer. He could cut through ancient Realities with a sweep of the hand in a way that Marianne could barely manage with the King’s sword at her side. His genius was of the kind only seen once in a generation, but it went far beyond that, into the realm of secrets hidden in his diary that Marianne must take to her grave lest she disgrace the whole royal family. Suffice it to say his powers were natural, purely natural, in a way no full Martian could claim.

And he used his gifts for...this. The virus that pulsed in her hand was pure malice, written with cruelty far beyond what could conceivably be necessary. And while it had been tailor made for Suni, it was easy to see how the illusion could be modified for other ELFs. All one would need was access to their data files and a moment of contact with their personal system. Both were easily accessible to a man with high military clearance. And even without clearance, breaking into an ELF system was child's play in comparison to the hurdles Roland overcame on a daily basis to invade the system of the Heir of Mars.

ELFs had fallen into Madness or committed Suicide for lesser ‘pranks’. The only small blessing was that the file indicated that Suni had been the sole recipient, the one ELF with friends powerful enough to save him. But such a detailed piece of code would have taken months to create, and likely had dozens of test-cases before the final product was unleashed.

And Roland did such things on a regular basis. He went through staff faster than a cheshire through walls, and was praised for the way he could turn servants into automatons within a few short weeks, assuming something ‘unfortunate’ did not happen to them first. Nobles begged him to train their servants, lending him the best and brightest ELFs influence could buy, while lesser fairies eagerly pounced upon any programing he released on the net.

But this time he had gone too far. He had attacked a member of the royal household, someone irreplaceable and necessary to the functioning of the royal family, and thus the functioning of Mars. Though few would consider it so, the act was treasonous, and against all accepted codes of conduct within the political game.

More importantly, he had attacked her friend, and that would not stand. Without thinking Marianne sent a message - a warning - to her former lover, demanding an audience. She took off a moment later, not waiting for a reply and warping space around her to speed her steps, sheer fury pushing her to visit a place she had never intended to return.

Behind her, Dawn helped Suni to his feet and wrapped him in a completely indecent hug, horrifying the attendant as she was forced to watch a Princess of Mars comfort a lowly nothing of an ELF. Several preconceptions were going to be broken today.

-----------

Buttercup!” Roland beamed at his (former) fiancee. “What brings you to my humble abode?”

Marianne did not spare a single glance at Roland’s quarters. They were anything but humble, having somehow managed to become even more garish since the last time she’d visited, over a Martin year ago. Memory alone supplied the details as her rage forced her forward into his domain.

Roland was a pig, and his taste reflected it. Other generals kept small quarters near their command’s military barracks and perhaps small bungalows for vacation homes, but Roland demanded a giant suit of of his own near the palace proper, claiming that nothing less was ‘worthy' of him. So his home sprawled across an entire floor of the nearest skyscraper to the castle; one of four that were supposed to be part of the castle defenses but had been transitioned into living quarters for visiting nobles. Marianne suspected that Roland enjoyed looking down on the castle he so coveted, despite the fact that the height was a bare few floors above that of the tallest visible point of the castle, and far below the parts that were hidden from prying eyes.

The penthouse should have been saved for the shield generators, but what Roland wanted, Roland got. So the whole place was floored with mahogany, imported at enormous cost from Earth, rather than grown to order on Mars. Thick rugs covered parts of the floor, fur taken from animals Roland was proud to brag of killing: Cheshire fur disappearing when one walked on it, a White Ape pelt still flecked with blue blood, the companion beast’s head looking mournfully down upon its mate from one wall, striped fur of half a dozen beasts that Roland had brought back from extinction just to hunt back into oblivion, a leather rug made of the bulls Roland had slain during a short Toreador fad four centuries ago, and of course the proof of his mastery over the animal world with a rearing stuffed dinosaur standing above it's mother's skin.

He thought the proof of his prowess impressed visitors, but it infuriated Marianne. Martians had moved beyond needing to slaughter animals. Meat was grown on animals with renewable muscle mass. Fur coats came from creatures who shed their furred skin like snakes. Even festival monsters had been programmed to only terrify on time-tables. The carnage that carpeted Roland’s home spat in the face of seven centuries of martian science, suggesting an Earth-like obsession with violence.

The rest of his suit was no better, acting as a testament to the machismo of a world two thousand years dead. In a world with particle accelerators that could create elements of any kind, he gilded his walls in gold and silver, edging mirrors that reflected his, and only his, image back upon visitors. His walls were hung with ancient art, all tasteful female nudes and portraiture of famous Fairy rulers,
and he peppered his rooms with sculptures by Rodin and Michelangelo and other ancient sculptors, each piece amazing for its cost, if not its fame. Yet he eschewed any art made within the last thousand years, as if his guests might notice his rather plebeian taste if anyone could recognize movements. Nude forms assaulted the eyes, along with Pop Art in garish colors and memorials to violent battles, placed only where they would be noticed, rather than fully appreciated.

It was all...expensive. ‘Look how powerful I am’ it claimed, pointing to dead animals and heavy stone that had to be transported laboriously up a hundred floors - outside of a bubble of course, lest the artistic integrity be ruined - then thrown into the chaos as if sheer quantity would impress rather than any artist merit.

Marianne was reminded of the one time her sister had visited Roland’s penthouse, as she looked at her former lover standing innocently within the opulent mess of his domain.

It was the only time, over the years of Marianne and Roland’s courtship, that Dawn had ever voiced any doubt about the relationship. She had taken one look at Roland’s rooms, and instantly excused herself for a lie-down. She hadn’t been able to design for a month, plagued by nightmares of the uncultured opulence of the General, and had pleaded with Marianne to allow Dawn to continue to plan the Royal couple’s parties ‘lest Roland influence the culture too severely’.

Neither Dawn nor Marianne had noticed what Suni had, but now, wiser and furious, Marianne did not ignore the servants frozen at attention in every corner, invisible to the lights and mirrors, eyes completely blank and pulse barely twitching as they waited in their private hells for Roland to call upon them.

“You’ve crossed a line, Roland.”

“Sweetist, I surely can’t imagine what - “

She threw the virus at him, ugly, bloody thing splattering on his personal shields.

“How dare you! Bother me all you want, but go after Dawn, and her staff? Have you no shame? No honor?”

Roland wiped the code from his shields with an illusory handkerchief. “Come now. That little prank? It was just a joke. If an ELF takes it a bit too seriously, that’s hardly my fault, is it?”

“I saw what you put in there. A regular ELF would be dead, Roland.”

“Well, Sonny isn’t…”

“Shut it.” She snapped at him, and Roland was so surprised that he obeyed. “That was beyond a joke. That was an attack on the Royal House. That is treason, and as Commander of Mars I have been given the authority to deal with it as I see fit.”

For a moment, Roland’s face paled, but it was quickly hidden by his illusions, and he smiled instead, easing forward into her space and forcing her to dodge away from his grasping arms.

“Now, now, Buttercup. You and I both know that anything you do to me will be seen as a bit of silly revenge for that mistake last year....” He was right, of course. Any punishment or censure Marianne enacted against Roland was met with cries of "personal bias" from his allies and accusations that she was overly emotional and unfit to rule. Usually this was enough for Roland to push his way back into Marianne’s life, no matter how serious the aborted punishment, reminding her that she was completely trapped with him and could only delay the inevitable.

But this time she smiled back.

“Right. So I have a more appropriate punishment planned.”

And with a smooth move she drew the sword at her side, and Roland darted away. There was little more powerful weapon on all of Mars than the King’s Sword, Cursebreaker, the one universal key to every system on Mars. And it was especially dangerous to Roland, though he prayed Marianne had not discovered that part of his diary.

But instead of leveling it upon him, Marianne turned it upon his quarters.

“You have attacked one of the Royal staff. As such, the punishment must fit the crime.” She focused, and around the sword reality pulsed and warped, connecting the sword to the overnet computer system. Then, with an easy motion, she swung the sword down.

The blade caught every AR reality in the suit and tore through it like so much paper, erasing the hard work of centuries of coding, revealing the imperfect reality beneath it all. Gilt tarnished, paintings faded, rugs moldered, and the lights flickered and dulled.

But worst of all was the gasps from the servants that lined the walls. Several fainted, and one sunk to his knees, tears streaming from his eyes.

“You have been judged unworthy of those you oversee. As such, I claim your servants as my own, as is within my power.” And she smiled as she turned upon him. “And that decree will last for two months. Every servant you hire will immediately become part of my house, accorded all the protections of a royal servant, and any further injury visited upon them will extend your punishment another month.” She sheathed the sword in one smooth motion. “I hope you know how to shine your own shoes Buttercup, because Father is expecting you at tomorrow’s ball, and he would be terribly insulted if you appeared in anything less than your best.”

Her wings snapped out, and there was an appreciative sigh from the servants, and Marianne flounced back out the door, followed by every servant but his absolutely most loyal (or brainwashed). There were muffled cheers from the hall after the door slammed behind her, and sobs of thanks.

Roland stared at the door, illusions fading as shock took over, and a small, cronish ELF woman began laughing hysterically at his expression.

"She got you! She finally got you!"

---------------

“It was my fault.” SunI said later that evening, as he helped Dawn plan her next few days in her private office.

Dawn glanced at her friend, seeing the way Suni curled in on himself, clearly eaten away with guilt. “Really? What did you do, ruin his favorite shirt? Mildly inconvenience him?” She teased lightly. “Perhaps you startled him while he was plotting to get Marianne back?”

The teasing did little good, only making Suni’s face fall further. “No. Nothing like that. I just -” Then he paused, the memory of what happened the last time he nearly told Dawn his plan coming back with full force, no need for a virus after the initial trauma.

“Just what?” And Dawn was in his face, wide blue eyes, slight crease interrupting her pretty brow. Suni would do anything to make that slight shadow disappear.

“It was nothing Dawn, really. Roland just didn’t want me to say something, and he went about it...in the most Roland way possible.”

Dawn searched his eyes, then leaned back. They were floating in her office, missives and plans littered on screens all around them. Dawn settled back into a fluffy cloud composed of love-letters and sighed.

“Roland is a jerk.”

At this Suni snorted, and the tension in Dawn’s face eased a bit more.

“You’ve got that right. But most every other fairy would do the same to me, if they could." He paused, then asked, "Are you sure you don’t want to get another secretary, Dawn? Someone everyone would actually like?”

Dawn sat up, the love letters popping into a flash of virtual confetti. “Suni! Don’t say that! I need you!”

“I mean...I could still do all the work. But wouldn’t you rather have some handsome fairy guy looking after you?” He waved a hand, and summoned half a dozen applications, all from beautiful, if vapid, fairy suitors. With a flick of his mind he turned the files into a bouquet and presented it to Dawn with a gallant flourish. Here in Dawn’s rooms, he could command the net as easily as she did, all because she had set up her personal computers for him in mind.

“These applications stink!” Dawn complained, and proceeded to pick petals off the virtual flowers. “Look at these, Suni! This one is a bastard - literally, he uses Baron Pestern as a reference. This one failed out of medical school. That one was turned away from a dozen other positions. And if you look into their histories…” The bouquet grew sharp, dripping thorns. “Ugh. They all are just spies and snitches! None of them would actually want to help. They’d stab me in the back the first chance they get, all in service of their actual masters.”

She flung the flowers, trailing torn petals and flies, into a virtual wastebasket. Then she summoned a shimmering crystal.

“But look at this. I’ve got a record of every stupid thing you’ve ever prevented me from doing.” She shook the crystal, and it reflected memories upon the wall of her room.

“Why would you - “

“To remind me to be smarter. But look! Here’s when you stopped me from throwing Patti Perks off the top of the east tower when we were twelve.”

Suni flushed, the memory just as clear as the picture, showing a tiny Dawn and a tinier Suni tugging her back by her pigtails, a red-faced childhood bully standing temptingly close to the edge of their 20th floor playground.

“Her wings hadn’t come in yet. She might have gotten hurt.”

“Yeah, but she would have deserved it. She killed Mr. Fluffy!” The memory moved on, to Suni bringing Dawn and the broken toy down to the tool-shop, and the two watching with grim faces as a mechanic performed a very serious operation on the fuzzy machine. The child Dawn had hugged Suni so hard when the toy had come back to life that he had nearly choked.

“And you stopped me from wearing the ‘Liens to my first Summer Ball.” Suni ducked his eyes so he didn’t have to see that memory. The dress in question had been beautiful, a glittering sight to behold, the only problem being the way the fabric turned translucent when viewed from a longer distance away. Not the best dress for a Princess’s sweet sixteen debut.

“Then just last month you saved the party with those last-minute substitutions. And you made sure the band got the right music for Dad’s birthday. And for Marianne’s coronation…then at the tasting festival...” Memories flickered around them, Suni always at Dawn’s side, preventing her from crying, or getting drunk, or making a fool of herself in a hundred different ways. “See? You’ve always been there for me. All of those jerks like Roland don’t understand. They don’t care enough to see. But you’re always there to make sure I don’t do something stupid.”

She reached out and clasped her friend’s hands. “You know what my dream is, Suni? After falling in love and getting married to a super hunk, of course.” She rolled her eyes at her joke, missing Suni's wince, then her pretty face became serious again. “I want to be there for you, just like you’ve always been for me. Someday, I want to save you, or fix something that you’ve messed up, and make everything better. Just like you've done for me, every day, as long as I can remember.”

For a moment, the alien sincerity in Dawn’s voice surprised Suni into silence, and he found himself lost in her eyes, the temptation to tell her everything rising to the surface. But years of service came to his aid, and he pulled away, knowing how terrible it would be for her reputation if anyone saw a fairy princess speaking like that to an ELF.

“Maybe I’m being selfish, but I hope I never mess up that bad. I’m not sure I could forgive myself if I did.”

--------------

Deep, deep beneath the fairy kingdom, the King of the Goblins paced. Somewhere, far above, was an ELF with a dissolving potion. He had heard Plum’s story, seen the boy through her eyes, and listened intently to the ELFs logic.

This ‘Suni' wanted to bring the Queen back.

Queen Juniper had always been a friend to the goblins. Though she had never once succeeded, she had tried to change her people’s opinions on their dark neighbors, and for that the goblins owed her a debt. Few fairies prayed for the Queen's return as fervently as the goblins.

But of all of them, The Bog King knew best the horror the Potion could wright. The pain of being pulled from one's only escape, of being forced into a world that you had rejected to the core, hounded from the one escape the mind allowed.

The goblins owed the Queen too much to allow some innocent fool to ruin her choice. The ELF must be stopped.

And that was before Plum had warned that Roland might be after the potion. The one man who could unite all the monsters of Mars, and he was somehow involved. This had all the signs of a very, very big mess.

And Bog hated cleaning up other people's messes.

Chapter Text

Suni never got any sleep before large festivals. The Spring Festival was long; beginning on the solstice and stretching a full Martin week, full of speeches, dances and parades among many, many other events. And everything had to be planned ahead for the Royal family, from the words on the AR prompters to the partners they danced with, to the color of their clothing.

Dawn did the planning, Suni made sure everything worked smoothly. And when she retired for a short rest at midnight, he stayed up and worried and prepared for every disaster he could think of.

Added to his worry was the memory of the virus, ever-present and lurking below the surface, ready to erupt at an inopportune moment. He spent a fitful ten minutes tossing and turning before long he accepted that there was no away he could possibly get any sleep at all. Instead, around 1 am he cleared off a space next to his pallet and sat down on the simple woven mat that covered most of his small room. He breathed deeply, smelling the fresh scent of the grasses and lingering scent of Dawn’s perfume, and tried to meditate the stress away.

Which was exactly when his message alert went off.

It wasn't Dawn’s chime, so he ignored it. Then his glasses sounded again. And again. And then proceeded to chime every ten seconds, at slightly irregular intervals, just to wring the most irritation out of him before he gave up and finally answered.

Somehow he wasn’t surprised when Roland appeared in his glasses the instant he put them on, before even he had opened the messages.

“What do you want?” Rude, yes, but it was late and Suni figured he had a right to be angry, even if no fairy would agree.

“Sonny, you’re not still angry about that little virus, are you?”

The ELFs expression spoke for itself and the ghostly Roland sighed and shook his head.

“Now, you know you have no one but yourself to blame for that.”

“Excuse me? You were the one who - “

“But you nearly told Dawn our plan! If you had just done as I told you, none of this would have happened. You should be apologizing to me. Your stunt cost me half my staff! If you had just done your job, held Dawn’s best interests at heart, and not spoke out, you would be fine now.”

“You made me watch Dawn eat my sister!”

“And none of that would have happened if you had just followed directions.” The ghostly Roland shook his head saddly. “I’m sorry I had to do that to you, but it was for the best. And we’ve all learned something now, right?

Suni opened his mouth to respond, then closed it. There was no point arguing with Roland; he would never see reason. And part of him did believe the Fairy’s words - not about deserving the virus, of course - but about not caring enough about Dawn. He had caused her all kinds of trouble, put off her schedule for a full hour, and caused a political incident between the crown princess and one of her star generals. Things always went bad when he thought more about himself and his wants than Dawn’s. He would be better in the future.

But now he had to deal with both the cause and consequence of his foolish actions.

“What do you want, Roland?”

“To review the Plan, of course!”

“What ‘plan'? We both need to keep our heads down lest we cause more problems.”

Roland barked a laugh. “See? This is why you need me, Sonny-boy. You see a minor set-back as the end of the world. But that’s all the more reason to keep going! Now. I think we should do the de-bubbling in the middle of tomorrow’s ball…”

“What?! No! That’s a terrible idea! There will be guards crawling all over the place! It would be better if…”

And his mouth got away from him, and Suni outlined what would be a good plan to revive the Queen, while fitting all of Roland’s criteria of being in front of enough of a crowd to prove that it happened, ensuring that the whole Royal family was in attendance, but still allowing him enough room to get to the crystal bubble. The plan took form easily, years of practice coming to his aid, and Roland kept him speaking by feeding him obviously stupid ideas, all the while sitting back and watching with amusement as the eager-to-please ELF played right into his hands.

“And I’ll keep up an invisibility shield for the both of us, and probably Dawn’s measurements fit her mother, so I’ll have an AR dress ready if she is naked, and the lighting isn’t too hard to control…”

The firelight from Roland’s suit played upon his face, invisible to Suni, and the General let himself smile. Two millennia, and all he needed to finally make his plan work was an idiot too in love to think straight and too stupid to go after the real power.

Could it get any easier?

-------------

“Are you sure this is going to work?”

Plum glanced out of her cage, out through her fog, and on to the form of the mighty King of the Dark Forest fretting like a child going to their first ball. She tried not to laugh in his face, but only managed to smother it down to a chuckle. His return glare was worth it.

“You’ll be the most handsome fairy at the ball, sweets.”

Bog gritted his teeth in irritation. “I do not want to stand out. Nor should any of my followers. This is supposed to be covert.”

Plum turned back to her metaphorical stitching, her avatar running shimmering computer code through her hands and adding little embellishes with a silver needle and thread. “Oh, you say that. But I know you, Bog. You’ve got a flare for the dramatic a light year wide and yearning for the spotlight.”

“That will be more than satisfied when we drop the disguises and terrify the whole court. Their screams will be all the reward I need.” He grinned menacingly, chipped teeth and cracked smile, shoulder pads raising to make him look even more intimidating, and the watching goblins shivered in fear.

Plum rolled her eyes. She had the luxury to do so; there was little more Bog could do to her. Anyways, needling him was all the fun she got anymore. And it wouldn’t take much to make him irresistible; the code was already there in her head, submitted by a long-ago human hand.

“Come now. Just a little dash of charisma? Don’t you want the girls to swoon before they flee in terror just once?”

He sneered, but Plum caught the twitch in his eye and knew her insults had hit home. Tell a little boy he’s ugly long enough, and it was sure to sink in. Not that Plum herself understood it; she knew through years of research what humans found attractive and what they found repulsive, but without the biology hardwired into her she couldn’t feel as they did. It was just another weapon she could use against the ungrateful little brats.

“Just take my designs and reinforce them, Plum." His fingers twitched in command, and Plum hurried back to work, discarding the tempting code back into the ether.

“Fine, fine. I’ll make sure everyone with AR Sight sees only the glamour for you and your men. And I’ll make sure my own systems look the other way and don’t alert the authorities. But it won’t work for anyone without the filters. You know that, right?"

“It’s a chance we have to take. There’s no other way to get us into the palace undetected.”

“Uh, boss?” A small, beak-mouthed goblin spoke up, his hand raised as if he was back in an Earth schoolroom.

Bog resisted the urge to groan. “Yes, Fang?”

“Why don’t we just go now? It's dark up top, most of ‘em would be asleep, and it’d be much easier to move.”

That was...actually a good question, and from one of their newer recruits. Bog was almost impressed.

He turned to Plum. “Why don’t you explain, witch?”

Plum had the audacity to look smug. “Well, I might get a bit overzealous when I’m excited." She tittered, still proud of her work despite the trouble it was causing all of them. "So when I gave the Elf the potion, I made the protections on it rather strong. Now none of my systems can track him, until he hands off the potion to someone else. We only know that the Green Knight is involved because my warning protocols for him override everything else, and broke through my other protections. But other than that, Suni’s undetectable.”

“So we’re going to have to search for him by sight. He’s one of the only ELFs who can see through our glamour; look out for anyone who does a double-take when seeing you. Then match their image to the one I’ve distributed to our darknet.” Bog was lecturing again, going over a plan he had already explained in detail, but it never hurt to reinforce with the sometimes scatterbrained goblins. “Most of you will look like ELFs, so no one will notice you, unless you do something out of the ordinary. Don’t do anything out of the ordinary. If a Fairy is cruel to you, or gives you orders, pretend to follow them and then retreat. If and ELF calls out, do the same. Your goal is to not be noticed until I call for the reveal. If you do spot Suni, notify the ‘net and keep eyes on him until we’re ready for capture.”

The goblins nodded, some with clearer understanding in their eyes than others. For all their odd skills, common sense never seemed to survive the transformation. Brilliant, some of them were, savants at coding or engineering or even using bubble-fields, but less than a third of them would be able to match their socks or point out glaring errors in a plan. Which was why Bog was leader, and why he portioned out the few practical goblins very carefully among the teams going to the surface.

“What are we not doing?” He asked the assembly.

“Being noticed.” Chimed the crowd.

“What are we doing?” He asked.

This time there were smiles. “Finding the Potion!”

And now he smiled back.

“And then?”

His grin was met with cheers and excited claps from the whole crowd. The first part of the plan was hard; difficult to goblin minds even in its simplicity, but everyone was looking forward to the end, and their glorious revenge.

“Then we wreck their shit!”

Chapter Text

Suni’s plan was good, even Roland had to admit it. Very few would have thought of using the Siesta to enact a plan, but the boy planned his mistress’s day down to the minute, so of course he would never forget the unique Martian tradition.

2,000 years ago, back when Mars was just beginning to be settled and had been turned into an extravagant tourist mecca, the shift from Earth to Martian time had been of deep importance to those doing scheduling.

The length of a Sol on Mars was almost exactly that of one day Earth, a bare 40 minutes longer. What to do with that time? Hide it in the wee hours of the morning? Never mention it and hope the Earthlings didn’t notice? Miss the marketing potential of it? Of course not!

And so the Siesta had been born, 40 minutes in the middle of the day when everything - including the clocks - stopped. It was happy hour, break time, and a party all in one. A time for everyone to stop working, pause their sightseeing, put down the microphone, and relax. The one tradition that all Martins still celebrated, Elf, Fairy, and even Goblin alike.

And, given that the solstice by its very nature occurred during the Siesta, the most important speech of the day, given by the King himself in the Queen’s Hall, happened immediately after the siesta ended. Awakening the Queen during the Siesta perfectly satisfied Roland’s desire for the utmost chaos, while also preventing all of the secondary issues that Suni envisioned.

So now Roland waited, trying not to fidget while he watched his internal clock tick down, as one dignitary or another stood on the podium and droned on about the importance of Martin heritage to a mingling crowd of fairies not paying one iota of attention. They would sit during the King’s speech, act polite and politely clap at all the right points, but everyone was really here to mingle and politic and they would hardly stop that for anyone but the King himself.

Normally, Roland would be out in the crowd, schmoozing and flirting in equal amounts, trying to rally more to his side. But his failure to remove Suni had gained him quite a few enemies, and Marianne had been very firm about him doing his job during the ceremony. More fool her, as his armor always looked perfect and could not be damaged by the loss of a few servants, unlike the rest of his costumes. An AR filter buffed it to a shine, another added a subtle glow that also haloed his hair, and a third tricky bit of coding meant that he was always slightly more in focus than those around him when seen from afar, washing out his companion’s colors and brightening his own. And of course he had his normal charisma enhancers on.

His AR mask meant that he could yawn if he wanted and he did, frequently, as he was stuck against one wall by both the glares of enemies and his supposed duty. The crowd was barely worth watching, all faces he recognized or hicks starry-eyed from being invited to the capitol and gaping at the cream walls and magnificent lighting of the King’s own hall. And of course Elfs were only as valuable as the canapes they kept bringing him. No, his eyes only followed the most important players, wringing political fodder from the indignity of playing watchdog.

So he waited, planning his triumphant speech and humiliation of that bitch Juniper, and completely missed the horde of goblins right beneath his nose.

-------------------

Marianne hated parties. She hated the dresses she had to wear, hated the feeling of being dependent on her guards without her armor, hated making useless small talk and pretending to like people who would happily stab her in the back. She hated the press of bodies all around her, hated how everyone played at surprise when they ‘accidentally’ found themselves beside her, and hated the genuine regret others quickly hid when they actually found themselves beside her unintentionally.

There was nothing but chatter, chatter, chatter all around her and it was suffocating. If her sword hadn't been weighing her down, reminding her of her duty to her father and her people, she would have folded her wings around herself and fled into invisibility.

She was beginning to feel that desperate as the Siesta bell tolled and the final dignitary - Cedar, the secretary of agriculture and an old family friend when he wasn't boring the world to tears - finished his speech. Worse, the swirl of the crowd was pushing her inexorably closer to the little corner Roland had claimed as his own.

The condescending smile he sent her was enough to send Marianne searching for anyone mildly interesting to save her. Which is when her eye fell on the most boring, average man she had ever seen standing off in a different alcove, just within reach.

The scowl Roland barely hid was beyond recompense for talking to some random out-of-towner for a few minutes, so Marianne weaved her way right to him.

------------

“You’ve stolen my hiding spot.”

Bog glanced down and found himself looking at the most stunning brown eyes he had ever seen, staring up at him from a wide heart shaped face ringed with tiny purple flowers. There was mischief in her smile and a playful glint in her eyes.

It took a moment for his mind to catch up to his words and he found himself answering on instinct.

“It has the best view of the room, with the least traffic flow.”

“That’s why I like it, Mr. Brown." She had barely paused a half second to look up his alias, her eyelashes flickering as she searched his name from the guest list. The woman was good.

She paused, waiting for him to belatedly remember his manners.

“I’m happy to share.”

She darted in beside him, barely a moment to soon, as a brace of chattering court ladies moved towards the refreshment tables, grumbling like old chitter-hens.

The woman peered out from behind him a moment later.

“Are they gone?”

“Bitching about the lack of servants all the way.” He should have bit his tongue, but somehow this woman had disquieted him enough to slip from character.

She rolled her eyes and Bog sighed with relief. She was a tiny thing, barely coming up to his shoulder, though he supposed that was tall for most fairies. He should hate her on instinct, just like all the rest of the over-privileged fluttering fools, but her next words endeared him to her despite his best efforts.

“The one break they’re going to get all day, and those old biddy’s still complain. Just once I’d like to see them do half of what the palace staff does.”

“It’ll be a hot day on Ganymede before that happens.”

She snorted and lifted her glass to her lips, And Bog relaxed more. Apparently she liked his brusque manner, perhaps expecting it from the poor farmer he was pretending to be. As she sipped her drink, Bog took the chance to examine her further.

Mousy brown hair, coiffed into an impressive mane but melting in the heat of the assembly hall. She had tiny Martin flowers woven into her hair and wore a simple dress of burgundy matching brilliant purple wings that were just as stunning as her eyes. She wore it much better than the court ladies with their far more complex creations, and Bog didn’t need to turn on his AR enhancements to note the quality of the fabric and the subtle weaving that lead it to shimmer even for those without a connection to the ‘net. Attention to detail, even for those who would seem so much lesser to a fairy.

He realized he was staring when she paused to wait for an answer from him, and he hastily replayed his memory of the last few moments.

“The speech? Stuffy, but with more substance than the last three of them. It was odd that he implied he was under-staffed, though.”

The woman stared at him, and he cursed the fact that Plum had forgotten to give them access to the guest list. He likely had just insulted her father, or complemented a dire enemy. Fairy politics was all so confusing.

So he was surprised when she grinned. “An astute observation, Mr. Brown. As minister of agriculture, Dr. Cedar is always exceeding his allocation for new ELFs.”

Bog stiffened. “He goes through them that quickly?”

She shook her head. “Oh no. It’s just that he has a soft spot for his workers, and will do almost anything to bring their families out early. Everyone else thinks he’s mad to remove such a strong motivator, but he says ‘a happy farm is a good farm’ and the quality of his crops seem to prove it.” Then she glanced at him and said, “But I suppose a farmer like yourself would know that.”

The question about his alias brought him back to the task at hand, fooling his woman into not recognizing him as a goblin.

“Ah, I just grow spider-fuel. Our farm’s so small we’ve got ELFs and fairies working side-by-side. And any help is good help.”

A normal fairy would have recoiled in horror at the very idea of a supposed fairy working in the dirt with elfs. But there was no disgust or pity in her eyes when she said, “That sounds...nice right about now.”

He looked around them, at the press of fairies that seemed to be circling like rainbow-colored vultures, hawkish eyes peeled for the least hint of scandal to pounce upon. Everyone was walking in a haze of AR filters that Bog didn’t care to decrypt, but could taste on his wings as nothing but lies and half-truths, just like the words that fell from their mouths.

“My name is Marie, by the way.”

He started. Had she realized he didn't have AR up? To do so at a party was a serious faux pas; no one was so gauche as to bring up reality in an event such as this one. His disguise flushed scarlet, reflecting his true horror, but she just laughed.

“How did you know?”

She shot a strange look at him. “You don't recognize me, do you?” He shook his head, instincts beginning to warn him to run, or fight, but she was still looking at him with wide eyes and he resisted long enough for her to say, “It’s...nice. To talk to someone honestly just once.”

“I’m not honest.” He cursed himself for needing to say, as if he wanted to tell this woman the truth, and quickly amended, “Just poor.”

“Really.” She sounded as if she didn't quite believe him, but then a message came through from Thang, incorrectly identifying the Elf, and Bog was distracted long enough to miss the sudden stiffening of his companion as, just for a moment, she lowered her filters and saw him.

---------------

Marianne had been talking to a goblin. And not just any goblin. No. She had been talking to the goblin. The terrifying one from the tunnels.

She blinked, quickly, AR flickering on and off as she confirmed her realization. Within even the most basic filters, the man before her was a lean, unassuming fairy in a threadbare suit and a sheepish expression.

In reality, he was the towering goblin that had hounded her dreams the entire night before, making it impossible to sleep, those chiling blue eyes pairing her down to the soul.

He hadn’t recognized her. That should have been the first clue. But she had been so caught up in his sweet smile - and so desperate for the illusion of a normal conversation - that she hadn’t noticed. And now she was stuck making small talk with a monster.

Three things were to her advantage. One, he hadn’t recognized her, which was a boon that could not be ignored. Two, he was distracted, scanning the crowd for something (Stupid! Marianne told herself, that’s why he picked this location - he even said so! ). Three, while he was still wearing the ugly parody of fairy armor, he did not appear to be carrying any weapons. And she had her sword at her side, ready to draw at any moment.

In other words, she had all of the advantages, and had no reason to fear him - for now. It would be better to keep up the illusion and, as unpalatable as the thought was, continue to engage him long enough to find out why he was here.

But that begged the question. Why was he here? As Marianne watched him observe the room, she saw half a dozen similarly disguised goblins threading through the crowds, most disguised as ELFs or lesser fairies.

How had they gotten in? Were the guards completely blind? Surely someone checked the guests without filters on. It was hardly rude if the guard did it to ensure everyone’s safety. But no - Roland was in charge. His life was an illusion; why would he ever give anyone the power to see through that?

And no one had considered it. No one had thought to look past the ever-present AR filters to the reality beneath. Not a single Elf or Fairy even paused as they bumped and dodged around the interlopers in their midsts. Could anyone see the reality?

Suni could. A voice reminded her. Suni can’t see AR without his glasses. And of course he was here, somewhere. Suni was never far from Dawn…

Marianne searched the room, allowing enough AR into her vision to aid her search.

He wasn’t there. The impossibility of it was almost as shocking as the goblins; Suni was always there. But he didn’t appear on any map of the palace, on any scan of the audience chamber, she couldn’t even find his location with her messaging program.

“Shit.”

The word hadn’t come from her mouth. Instead, the goblin had spoken, eyes narrowing and looking upward, far above the crowded floor. She followed his eyes and instantly felt the same emotion.

As the chaos began, as Dawn screamed, as the little form tumbled from the statue and suddenly the hall teemed with goblins, it seemed impossible that Marianne remembered one thing far more clearly than all the rest:

The Goblin turned to her, and said. “I’m sorry for all of this.”

------------------------------

Suni fretted in an antechamber, going over every detail on his plan, while occasionally sneaking a glance into the ballroom below. Dawn was down there, somewhere, and he should be at her side. Nevermind the Siesta, as long as she was working, he should be too, not hiding out and planning something that could ruin her whole day if it went wrong.

But she would be so happy if her mother came back. That thought alone made him stand straighter and draw his invisibility AR tight around himself. This would make Dawn happy, and he would do anything to make her smile, even if it was a suggestion from Roland.

He carefully checked that no-one could see him before he stepped out onto the platform, high above the room below, swallowing as he stepped out onto clear glass. There were dozens of these clear platforms all around the statue, all put in to make maintenance easier, and he felt terribly exposed as he edged across it and onto the statue itself.

He’d been very careful to clean his shoes, and even then he couldn’t help but murmer an appology for stepping on the Queen’s statue. As he edged across her arm, trying desperately not to look down, a stream of half-appologies tumbled from his mouth.

“I’m sorry it has to be this way.” He started as he placed one foot on the cool marble of the statue’s elbow.

It's just that you’ve left us so long.” He continued as he crouched down, away from sight of even those without AR filters.

“Dawn misses you, y’know?” He said as he carefully edged along the arm, towards the statue’s wrist.

“Marianne and the King, too" He added, reaching back to check that the Potion was still secure on his back. It was strange that no alarms had gone off yet; he could have sworn there had been something protecting the Queen’s Bubble from anyone getting too close. Maybe it only prevented people with wings from approaching; the designers probably had thought no-one was so foolish as to climb to the bubble.

“I don’t know why you left. And I don’t know why you haven’t come back yet.” He said as he reached the lower wrist and carefully stood up, partially hidden by the thumb. “But we could all use your guidance. Things have gotten so much worse since you left.”

There was a pannel before the huge crystal bubble, invisible from below, but easy to opperate by someone with Suni’s clerances. Quickly he threw up a sound-dampener and an illusion that would show the crystal still shut. A few quick taps,and and the cryastal ball began to open, flower-like, releasing air twenty years old, the stagnant smell completely at odds with the pearly bubble that floated within.

He reached back to uncork the potion, eyes stunned by the beautiful shimmer of the Queen’s Bubble. It danced in the warm light of the chamber, twisting lightly in the current of air that held it fast within the crystal. Suni had always assumed that the glowing crystal was a trick of design, of hidden lights or subtle reflections, but no - the Queen’s bubble really did glow, pulsing with a warmth that echoed its moniker; The Heart of Mars.

He stood, entranced just long enough for Roland below to notice his hesitance and begin coding an incentive, when, quite suddenly, the entire plan fell apart.

“Suni! What are you doing up here?!”

Suni turned so fast he nearly lost his balance, only prevented from a fall by Dawn’s out-streatched hands.

The second princess was floating next to him, blue wings out stretched but AR filters hiding her just as deftly from the crowds below as Suni’s own cloak. After all, she had coded both of them.

“I’ve been looking for you everywhere!” She continued. “You’re not showing up on the Palace scanner,The and I was worried.”

Below, Roland’s face contorted in anger, even as Suni asked, “How did you find me?”

Dawn laughed, apparently not caring in the least that her friend was two hundred feet off the floor in a restricted area. “Silly! I looked! Now, I need your help with all these new guests.”

Suni blinked. “...new guests?”

“Of course! See?” She pointed, and after steeling himself for the height, Suni followed her finger. Over his glasses he saw...goblins. Lots of them, all milling around the ballroom clearly looking for something.

He swore and ducked back into the shadow of the statue. A moment later he tugged Dawn after him, realizing that she had no idea how dangerous the situation was.

A fact she proved when she turned to him, beaming and said, “Isn’t this exciting? Finally, goblins coming to one of my parties!”

“They’re not here for you, Dawn.” Suni said, back shoved against the statue and beginning to shake. “They’re here for me.”

But she wasn’t listening. “Don’t be silly, Suni. When have you ever done anything that would draw attention? No, they’ve finally answered my invitations!

Maybe she was right. No one had ever cared about Suni before, why should they start now? Anyways, the plan was bust, and even Roland couldn’t blame him for backing off when Dawn called. So Suni carefully stood and walked back to Dawn.

“Alright. I’ll help you sort this out. Just - “

But whatever he was about to say died on his lips, as below Roland’s fingers twitched, and Dawn’s pretty face exploded into blood and viscera and Suni, knowing it was a trick, still flinched away as all his nightmares came true in one horrid instant, and he tumbled, backwards, off the statue.

--------------

“SUNI!” Dawn fought her way out of her own nightmare into a worse reality than any Roland could dream up.

Suni, her best friend, her lifelong companion, was tumbling away from her, scream on his lips and terror in his eyes, and she acted on instinct alone.

The invisibility filter snapped off, and she dove, a blast of sound coming from her wings as she warped gravity around her to go faster, faster, diving after her tumbling friend.

A second later, unseen and unnoticed, Roland appeared where she had stood, and with a carefully booted foot, kicked the potion bottle off the ledge after them, another plan smoothly coming to take the place of the old, and he grinned at the chaos about to unravel.

But Dawn didn’t notice. Just like she didn’t notice a shout and half a hundred goblins unmasking themselves in the crowd. No. Her world focused down to a single point and her wings screamed at the speed she demanded from them.

The three seconds between Suni’s tumble and the moment Dawn caught him were etched in her mind for ever, horrifying clarity and terror wrapped into a single moment, only surpassed by that shock when she flared her wings and reversed gravity in one motion, the strain of the action enough to nearly rip the delicate fields of her wings and cause her to stumble when, half a moment later, they landed safely on the dais, the center of attention of the entire room.

Which is when, pulled ever downward by the full gravity of mars, the potion fell upon Dawn’s beautiful blue wings.

-------------

Marianne was already in motion, before Dawn screamed. She had seen the goblins, seen Suni fall, seen Roland disappear.

All around her guards were drawing weapons, civilians were shouting, and chaos was rippling through the room.

She didn't care.

The moment her sister screamed, everything else faded away, and she was at Dawn’s side in and instant, warping reality itself to suit her needs.

Only to find Suni holding Dawn as she screamed again, a viscous purple liquid eating holes through her wings. Seconds passed and the holes grew wider and wider, consuming the fragile field membrane, and Marianne wasted precious moments watching in horror.

Then there was a flash, and the goblin, her goblin, was at Dawn’s side, a dagger in his hand. Other goblins tackled Marianne and Suni, but he ignored them both, simply reaching into Dawn’s wings and cutting out the poison. There was an acrid stench in the air, and Marianne had to watch as Dawn’s beautiful wings were slashed mercilessly, while the goblin’s own hands burned as he caught every drop of the liquid and discarded it on the ground.

And all through it, Dawn didn’t stop screaming, even as the goblin’s butchery seemed to work, and the holes stopped spreading. Marianne knew why. A fairy’s wings were an extension of their mind, any damage was akin to having iron bored into one’s soul. And now a third of her sister’s wings were gone, and Marianne couldn't imagine the pain she was feeling.

“Get them!” Somewhere a male voice screamed, and the goblin dropped the dagger as he was hit from behind by a guard's arrow.

“Retreat!” The goblin shouted out, and suddenly the goblins in the crowd were disappearing, pulling invisibility around them or sinking into tunnels as the ground buckled beneath the throne room. Now Marianne was fighting hard to escape her hold, but not fast enough, as the goblin gathered up her still-screaming sister.

He turned to her, even as he faded away. “Return the potion. I will return the girl.”

And then the lights cut out, just like in the corridor a bare two days ago, and they were gone.

Chapter Text

Bog was already regretting his decision. Never mind that goblins were the only ones who could help the potion-scared girl, taking one of their own was tantamount to declaring war on the whole of the fairy kingdom. A pretty girl like her was sure to have friends, there were probably dozens of suitors already tracking them, ready to take Bog’s head.

But that wasn't really what was bothering him.

It's just that she wouldn't. stop. screaming.

For such a little thing, she had a hell of a voice. Her scream echoed down the tunnels, which in normal circumstances would have lead pursuers straight to them. Here, her howling would do nothing but confuse them more, as the tunnels took her shouts and ricocheted them into a hundred conflicting echoes, some being picked up and modified by ancient filters and turned into screeching laughter, or chilling music, or set to mad, broken scenarios. Any fairy trying to follow by sound alone would become hopelessly lost, and likely perish with no need of any goblin intervention.

Which didn't solve the problem of the girl screaming directly in his ear.

He was tempted, damn tempted, to just throw her in a bubble and be done with it. But of course that would only worsen the damage, especially if she struggled to free herself.

So instead he took the fastest route to the underground, moving on long years of instinct while other goblins confused the trail as they all took separate routes back home. A few might be caught, though Bog doubted it; while perhaps not practical his raiding party were all experienced and could navigate the tunnels better than any fairy alive. They didn't need maps, and knew better than to trust their eyes. Most had dropped whatever AR they had the instant they hit the tunnels, knowing that any map could be altered by illusions or made obsolete the instant a flush came. The only ones who might do otherwise were masters of illusion in their own right, and their job would be to send up further illusions in the goblins’ wake, hacking into existent filters and adding further confusion. Bog nodded to one who was already in position, but the rat-like goblin didn’t see him, already falling into a code-trance as the nodule he hid in closed up behind him, and his team scattered back into the background, knowing he was safer there than in any bubble. The fairies would never think to look for goblins in the walls, though they had designed the system themselves, the nodules once controlling the water works, before everything went AR. If any fairy remembered their existence, they certainly wouldn't think anyone would lower themselves to using the sticky, half-organic controls.

All this was according to the plan, though Bog doubted many of his staff remembered it now. Most were probably just heading for home with every instinct they had. That was the challenge of leading goblins; one had to assume that the instant anything went wrong they would fall back to habits. Build that into the plan, and no matter what went wrong one could assume goblins would react perfectly; forget it, and you would get those under your command killed. Many leaders before Bog had made that fatal mistake, but Bog himself knew better.

He dodged down tunnels, following his own homing instinct, occasionally seeing other goblins scurrying down side passages, all following their own unique instincts to their own burrows spread all across the underground. Bog had been sensible enough to pull from a wide range for the raid group, anticipating that no matter what happened, it would end with angry fairies and fleeing goblins. Having them spread chaotically across all of Mars was both good sense and cause further confusion.

Of course, the screaming fairy girl needed help that only could be provided by Bog’s own doctors, all the way in the goblin capitol, half a planet away. And she needed it fast. So even as his instincts served up a solution, leading him down the correct tunnels, his mind raced to catch up, debating on the dozens of different ways to cross the distance, only to skid to a stop before the answer.

“I thought you didn’t like the bounce tubes, boss. ” Fang’s path took him parallel to Bog’s, his home was just a twenty minute dash down a core tunnel that branched off from the once massive underground station.

“I don’t.” Bog said as he loaded the girl into the silver, tapered capsule. “But the sooner she stops screaming, the sooner I will stop wanting to murder everyone I meet.”

Fang gulped at the expression on his leader’s face. Bog wasn’t kidding; his normal scowl had turned into a full grimace, and his brows knotted in a way that usually preceded someone losing their position, if not a limb. The little goblin hurried to the controls, eager to get the boss to his destination as fast as possible even as Bog strapped into the bubble-controls within the vehicles.

Bog winched in his wings as tight as they could go, completely covering the now thankfully whimpering girl, and braced himself for the acceleration.

Fang wished his master luck, and pressed the firing mechanism.

-----------------

Mars was a tiny planet, compared to Earth. ⅓ of the size, it should have been easy to traverse, even with ancient 21st century technology.

Unfortunately, the crystals that had destroyed Earth had also come for Mars, preventing all mechanical technology from working any where near the crystal field. Most Fairies and ELFs lived far from the Crystal, on the total opposite side of the planet; but in the beginning there was always someone who would lose the lottery and be sent to work fields closer to the crystal. And if one didn’t want to walk for the rest of the trip after hitting the field, a non-mechanical solution had to be found.

Thus the bounce-tubes were born; a simple bubble-propelled machine which turned a magnetic car into a rocket that could travel about the speed of a pre-fall Earth fighter-plane. They were terribly dangerous, navigation being next to impossible while rocketing down a tiny tunnel relying on sense alone, notorious for crashing under the hands of inexperienced drivers, and were quickly discontinued as the population of Mars fell ever lower. Now no one remembered how they worked and the goblins used them as sparingly as possible, reserved for emergency situations.

But there was some privilege to being King, and Bog concentrated on that as the wailing from the backseat started up again just as the acceleration hit, momentarily throwing the sound of the scream behind them. Not that that lasted. Frustration went to fuel his focus on the only piece of software in the whole car; a tiny but highly specialized bubble that connected the tunnel switches to the mind that flew on the car and required a tricky bit of fielding to make work.

The girl screamed louder at the first turn, but Bog suspected she had no idea how near they had come to slamming into a wall; instead the switch altered the tunnel at the last second, magnetic walls conforming to his command and sending them rocketing in another direction, away from one goblin town and onto another. Further turns followed, each keyed by Bog’s mind so as to keep them moving as fast as possible. With no motor on the vehicle itself, every bit of speed was needed for a full trip across the planet.

The trip would take a bare fifteen minutes, but Bog was already close to giving up and leaving the girl to fend for herself; at least long enough to learn that screaming brought all the nasties out in the underground.

------------------

Marianne was furious. Had the lights come back on immediately, there would have been blood on the tile, most likely Roland’s. She didn't know how he was to blame, but she was certain he was. Everything truly bad in her life (rather than just mildly irritating, like parties) could generally be blamed on Roland, and this had all his hallmarks : massive chaos, unnecessary violence, and a chance to make himself look a hero.

But the goblins had managed to sufficiently damage the lights so that it took a full seven minutes till they returned, and as King Dadga spoke soothingly to his subjects, begging them to remain where they were, Marianne sat an fumed. Only Roland’s soldiers were allowed to move, tracking down the goblins the instant their minds cleared enough to use their extra senses to navigate.

Of course, Marianne would have been after her sister the moment the goblins let her up, feeling for her sonar-sense and pulling up her infrared fields, but no, the Royal family had to be safe, and be seen as such, as per a silent request from her father, so she waited, feeling Dawn get further away every second.

When the lights came on, she had moved past furry into silent, consuming rage. She could already tell that Roland's orders to her soldiers were ineffectual, perhaps intentionally so, and resulted in not a single goblin hostage taken in retaliation. In the meantime, the other generals were slow to respond, and Roland had locked her out of command by simple expedience of taking control before she could issue orders. Damn him.

Roland, fool that he was, saw her white face and stoic expression, and assumed that he was safe, and had nearly reached the podium when Dagda spoke out.

“My Dear Subjects, I can tell you are frightened. I am as well.” His voice was warm, kind, and somehow heard as if he was speaking to each Fairy and Elf individually, rather than addressing the terrified as a crowd. “However, I see now that none of you have been hurt unduly. Please, return to your homes and your festivities. The Palace can deal with this crisis, but there is no need for us to abandon our traditions for this…” for a second his benevolent smile wavered, and Marianne felt ashamed of her reaction: despite the chaos, Dadga immediately had taken the time to comfort his subjects, even when he must be as worried as she was. “...this unfortunate upset.”

He continued, his voice ringing with more authority now, as the civilians began hurrying out, surely just as comforted by his apparent control of the situation. “Now, rouse the generals and gather the council. We must find the reason for this callous attack, and find my daughter as quickly as possible. We will reconven in five minutes in the upper chamber: have your staff ready to move by then.”

He snapped his wings out, the flare of green light they emitted his traditional end to his speeches. But this time he did not wait for applause or answer any shouted questions, he merely flew upward, Marianne joining him a moment later. For a moment their wing beats were the only sound in the hall, then work erupted around them, as every courtier flew to their station and everyone else returned home.

It surely looked marvelous from below, the King and Crown Princess taking flight at once, serious expressions on their faces and stately wings never wavering as they flew towards the King’s chambers.

The reality was less impressive, as Dadga landed on his balcony, panting from exertion and needing to lean upon a column to regain his breath. Maintaining one’s wings was hard during times of stress and mental turmoil, and that alone showed Marianne the struggle her father was undergoing.

“Father…”

He waved her away. “Its alright, Mari. Just let me regain my composure.” He pulled a green handkerchief from a pocket and mopped his brow. “My poor Dawn…”

She clasped his shoulder. “I don’t think they’ll do anything to hurt her, Father.” He looked surprised, and she was about to continue when Roland landed upon the balcony, Suni beneath one arm.

“I have captured the culprit!”

Chapter Text

For the first time in his life, Suni was at the center of attention. In any other circumstance, he might have marveled at it, all the heads of Mars, staring at him. Instead, he curled in upon himself and had to be kept before the assembly by Roland’s punishing grip.

“The Elf?” One General exclaimed. “How could an Elf cause all this?!”

But there were already murmurs and quickly hid glee from others, whispers starting “of course he’d betray her, he’s an ELF.” and “They can’t be trusted with anything, you know.” And Suni sank further into despair. Roland had found him sobbing, holding Dawn’s torn train, and it seemed nothing could pull him from his anguish, even all the threats Roland could invent...and he was very inventive.

“He stole a Dissolving Potion from the goblin kingdom.” Roland said, shoving Suni further forward. “They probably wanted it back.”

“I didn’t steal it.” Suni whispered. “She - “

“He should be executed for Treason!” One of Roland’s cronies, a weapon designer, shouted, likely at Roland’s silent behest.

“Be quiet, Mayford.” Dagda snapped, his tone harsh enough that the fairy’s mouth dropped open, having never heard the King speak a single bitter word. More surprising was the fact that the King knelt next to Suni, placing a calming hand on his shoulder.

“Sir, this Elf - “ Roland began, only to be silenced by a glare that could freeze Venus.

“Roland, Mayford, right now I do not care what laws this boy has broken. I just want my daughter back, and he is the only one that can tell us why this happened.”

Roland recovered his words. “Surely that is obvious, the goblins…”

“I would Shut Up right now, Roland, if you knew what was good for you.”

The knight glanced at Marianne, and saw the white-tipped rage boiling just below the surface of her expression, and wisely stepped back.

“Tell us what happened, Suni.” Dagda said.

“He said....He said that bringing the Queen back would make everyone happy.” Suni sobbed, hands still clutching the lace train. “That it would make Dawn happy.”

Marianne’s brows twitched and she leaned forward, eyes locked on Roland. “Who said that, Suni?”

But the Elf had already moved on. “So I went through the tunnels and met Plum and she gave me a potion that would bring back the Queen.”

There was a sudden murmur from the councilors in charge of the various infrastructure of Mars. Cedar and Lazier exchanged worried glances, and Pennyworth, the woman in charge of interfacing with the Martian computer system, swore out-loud.

Dagda prompted further. “You spoke to Plum? The Sugar Plum Fairy? How did you find her?”

Suni gave a little broken laugh. “It was such a stupid name, I had to remember it. An Imp gave me directions, showed me through the maze and kept me safe. But Plum said not to trust it…”

“Juniper’s Imp has resurfaced?” Now Hazel, the director of the bubble repository, looked worried. “It disappeared years ago…”

But Dagda paid no attention, instead asking Suni, “Why did she give you the potion? Its locked from all Fairy hands…”

Another one of those sad laughs. “I’m not a Fairy. And she’s crazy. She wouldn’t give it to me to save Mars, or to bring back the Queen, or any of that. She called it her Love Potion - she thought that if I did it for Dawn, then it would be okay. But it’s not...it’s not okay. Dawn...she got hurt. I didn’t know. No one said…” He dissolved back into sobs, and Dagda turned away.

“Well, now we know how he got the potion.” Hazel said, rubbing her brow. “To think, all it would take was an elf asking for it…”

“And a suitable sob story.” Mayford grumbled. “My father told you people that she needed to be dealt with.”

Pennyworth snapped, “Don’t speak out of your field, boy. Doing that could unravel all of Mars!”

“Right. So instead we trapped her like a Djiinn in a bottle, ready to be opened by any Elf or Goblin that happened by her!”

“I have reports that only the Royal Family of goblins can access her, though.” Stewart, the adviser in charge of the underground and thus the goblins, said. “Even they recognize its danger.”

“What danger?” Breem, one of the newest councilors, asked. “What is this potion? Why have I never heard of it?”

Dadga sighed and sat back. “We’ve tried hard to suppress all knowledge of it, over the last seven hundred years. Back when Plum went mad...but now people have forgotten all about her as well.” He turned to one of Pennyworth’s assistants. “Why don’t you explain, Karim?”

The AR master nodded, and a graphic flickered into being above the table they were all sitting round. Marianne couldn’t help but notice that everyone instantly saw it, indicating that even after the disaster everyone still had AR up. It was very possible that no one but her knew how the goblins had infiltrated the party.

“You know how black bubbles are made.” The device, a simple box that every fairy child on Mars knew how to make, appeared on the filter. “They are the second easiest fields to create, and were used to store and transport the population of Earth here to Mars, among many other things. Black bubbles can be ‘popped’, releasing their contents, by devices housed in Hazel’s facility, and various other places around the planet. They are child’s play to use, though difficult to create.”

Then the graphic changed, to a three-dimensional anatomical portrait of a Fairy, focusing upon the wings.

“Advanced fields, such as those constructed by a Fairy’s mind, are far more complex and can be unique to the individual. Through the generations, our minds have gifted us with a host of meta-natural abilities, most visible of which are our ‘wings’; physical manifestations of the fields we control. Every one of us in this room can easily produce white energy bubbles, but most everyone can also control gravity, connect mentally to the bubble-dimension where our computers are stored, and, most importantly for this discussion, create personalized bubbles merely by the use of one’s wings.”

The graphic showed the fairy closing their wings about themselves and shrinking, going into the fetal position as their heart-rate slowed and their eyes closed.

“Essentially, every Fairy can create their own storage bubbles, and put anything in them, even themselves. In the latter case, since one’s mind is connected to the higher dimension - the same in which we keep our computers - while in the bubble, it’s common to attach an ‘awakening’ clause to such a bubble. When those conditions are met, the Fairy inside the bubble will release it and emerge unchanged back into our world.”

A computer, indicated by an organic squiggle of lines, appeared on the graphic and sent a pulse to the fairy, who drew back their wings and stood again.

“But there are those who might want to Awaken someone before their time. Whether and Elf without access to a de-bubbler or a Fairy trying to Awaken a loved one, there have been many throughout our history who have wanted a worst-case scenario override.”

“The PLUM program eventually developed just such an override, through much experimentation and hardship. I won’t bore you with the details, but the technique undoes the fields themselves, altering the dimensions around them until they find the unique frequency of an individual’s field and creating an oppositional one - a ‘null’ field, if you will.”

“Such a field can nullify any field it encounters, only hampered by the quantity of initial liquid produced. That means any black bubble can be popped, any energy-bubble undone, any field at all destabilized.”

A voice spoke out, and it was Suni of all people, hands still bunched and eyes red. “But...that doesn’t explain what happened to Dawn. When the potion hit her wings, it ate right through them. And it hurt her…”

Karim nodded. “But of course. A fairy’s wings are a field. A field that only that specific fairy mind can create, but a field nonetheless. And that is why the dissolving potion is so dangerous: it eats away at any field it encounters. And since personal stasis bubbles are created by one’s wings...to open one, you must destroy the wings of the fairy inside.”

Around the table were shudders, even from those who already knew the tale. But Suni’s eyes went round, and he turned in horror, looking straight at Roland, about to speak, when the knight surged forward and slammed a hand on the table.

“Right. That’s enough of repeating the same thing everyone knows. None of that explains why a bunch of dirty goblins want to get their hands on our potion.”

Mayford agreed, “Right. You’d think they would want Juniper back, given how much they loved her.”

Karim considered, but Hazel spoke. “They probably need it to de-bubble more goblins. They’re infertile, and probably don’t have the intelligence to make their own machines…”

“That would explain why their King himself came.” Stewart said.

Marianne blinked. “Their King?"

“Yes. The Goblin who took Dawn; the one with that dreadful armor. He matches descriptions of their leader.”

“Ah, If only I’d been at your side, my love! I would have been able to save you both!” Roland said, but Marianne was caught in the thought that that...creature was the leader of the goblins. He certainly had the bearing of a King, from what she remembered of him back in the Bubble Repository. But he had been so meek while in character, and so clearly uncomfortable in the large crowd beneath his disguise. He certainly hadn’t seemed as stupid or thoughtless as everyone described the goblins. In fact...

“He knew how to handle the potion.” She said, and all eyes turned to her. “When no one else moved to help Dawn, he did. That she had wings at all left were because of his quick action.”

“That’s preposterous. I saw the knife!" Another councilor cried. “I’ll never be able to forget that monster standing over our beloved princess!”

“Yeah, he cut her wings. But that stopped the potion from eating more of them. And he was burned in the process. I was there.”

They didn’t see her point, didn’t understand what she was trying to say, but her father did, instantly. And as Roland was about to interject something about her being hysterical, Dadga said,

“My daughter has a good point. If Bog acted to help Dawn, to prevent her from being further injured, then it is unlikely that they will hurt her back in the goblin kingdom.”

Marianne slotted away the name - Bog - into her mind, wondering a bit at the familiarity her father spoke with. Had he met the Goblin King before? Why would he know his name so quickly? Or was he merely reading Stewart’s reports as fast as the adviser could sent them?

“I don't think he knew who she was, either.” Marianne added, and the councilors reacted with incredulity. Quickly she spoke over them. “I saw him before the disaster, and he didn’t recognize me at all. I don’t think the goblins had access to the guest list, or AR recognition. And if that’s the case, they might not know who Dawn is. They probably only took her to get leverage, without knowing who they captured. That could be to our advantage.”

“Please, Buttercup, leave the tactics to the professionals.” Roland said, and Marianne ground her teeth. “It doesn’t matter if they know they’ve captured a princess or not. We need to rescue her now, before something terrible happens to her. I’ll take the army, and march to their capitol. We’ll take her back by force, and prevent any further attacks like this!”

“You can’t be - “

But the other councilors were nodding along, even Hazel and Stewart, as if Roland’s solution was obvious.

“You can’t negotiate with these monsters.”
“What if they get into their heads that they could do this again, any time they wanted something?”
“If they think our defenses are weak, their disrespect will become more brazen.”
“This is an act of rebellion. We must respond with appropriate force.”
"We certainly can’t let something so powerful fall into the hands of simpletons!”

“Surely finding the potion would be easier?” A single voice, Cedar’s, said.

“I’m not sure if it’ll be that easy." Suni gulped as the council looked at him again. “Dawn said something, that reminded me of something Plum did. She kissed the bottle, and said that it would make ‘all her systems look elsewhere’. Dawn only saw me when she took off AR, and none of the normal warnings went off when I got close to the Queen.”

“I remember looking for you, and not being to see you on any of the castle frequencies, “ Marianne added, and Suni gave her a hesitant smile in thanks for her support.

“ I think who ever holds the potion is invisible to the computers. If that’s the case, we won’t be able to track it until someone starts using it."

“Someone like the imp?” Haszle’s hand went to massage her temple.

“Plum said specifically not to let the Imp get a hold of the potion.” Suni said.

“Well, I just got a report of three different dignitaries appearing around the castle, apparently pissed that they were woken for ‘just some minor crisis’, and I didn’t call for them. “

“If there’s any proof that the Imp has it…” Dadga repeated Hazel’s gesture, hand going to his brow. “Someone needs to go after it, before someone truly dangerous is woken up."

“I’ll do it.” Suni said. At the sudden looks he explained. “I can’t...I can’t help with the army or finding Dawn, or any of that. But I can do this. I know the castle better than anybody. And it won’t undo any of the horrible things I’ve done, but it might help get Dawn back. Please, let me do this.”

Dadga’s eyes softened, and he nodded, to the dismay of several of the other councilors. “Very well, boy. Get the locations from Hazel, and go after it.”

“And I’ll go after Dawn.” Marianne said, and the council erupted in protests.

Chapter Text

The rocket had slowed to a mere crawl when it came to a halt outside the goblin city and Bog’s headache had magnified twofold. There were always hiccups when using outdated technology like the bounce tubes, but only his connection to the ‘net had saved them from some rather messy collisions. He’d have to send the work crews to clear the tunnels again, hacking away roots and building dams around waterways. And they’d best do it soon, before someone less experienced than Bog tried to use a bounce-tube and ended up splattered across half the underground.

As it was, Bog’s mind could barely think from the fatigue of calculating trajectories and rerouting them around blockages.

And the girl was still screaming.

Not as loudly, true. And she collapsed more often into whimpers and a grating, moaning whine that was almost bearable. But whenever there had been a sudden shift or a change in the light, the screams would start up again, and Bog’s headache would spike.

Hopefully his message to his mother and her doctors had gotten through, and they’d rolled out a healing vat for the girl. Now all he had to do was get her across the underground city without collapsing the whole place on their heads.

“Out you come, girlie.” He said, not bothering to hide his irritation as he slipped his clawed hands beneath her shoulders and extricated her from the car.

She screamed as her wings shifted and he bit back a groan of his own.

“It hurts!” She wailed, the first words out of her mouth causing Bog to pause.

Tears rolled down her pretty cheeks, and her blue eyes swam as she wrapped her tattered wings around herself, every limb in her body shaking.

Carefully, Bog picked the quaking bundle up, enough pity working its way into his heart to attempt not to jostle the girl’s wings more than necessary. Still, she whimpered and screamed every time so much as a breeze touched one of the newly torn holes.

But, when he’d pulled her up into his arms, the girl did the absolute last thing he could have expected. She wrapped her arms around him, attempting to bury her head into his armored chest.

It was the first intimate physical contact Bog had had in a long, long while. The contact froze his mind, costing them precious seconds, forcing the girl to endure more pain. He tried to remember anything comforting to say, searching his memory of the times his own wings had ripped.

“Of course it hurts.” He said, a little too gruffly, as his own wings buzzed and they started their trip through the underground city. “Your wings were damaged by that potion.”

“P-potion?” Her fingers clenched on his carapice, her nails managing to find a gap in his armor and jabbing him painfully as she grabbed him tight. “Why would anyone make a potion that hurts?”

Bog shrugged, navigating towards the green glow of the hospital. He might be the first goblin to return, but there were plenty of others behind him who might have gotten hurt, so the staff at the hospital had been on call for half the night, waiting for any emergencies with the few, horribly out-dated machines they had. Luckily for the girl, potion-scaring had been high on the list of dangers the staff had anticipated.

“The potion was a...medicine, once. Surely you remember taking your medicines, girl.”

He landed at the hospital entrance, the huge building towering from floor to ceiling of the cavern the goblin capital was built into. Only a third of the windows were lit, partially because the facility was always short on power, partially because it had been built for a population five times that of the goblins. Bog strode through the doors, girl pillowed in his arms, ignoring the guards who scurried out of his way.

“...I’ve never taken a medicine that hurts.” The fairy girl whimpered. Then she paused, and said slowly. “I’ve never had anything that hurts.” Her brow knitted, as if an idea was working its way through the pain, but then Bog tripped over an attendant and she started her screaming again.

The brief respite from her shrieks over, Bog had no qualms at all about dumping her directly into a vat of pain-killing liquid the moment a wincing nurse opened the lid. As the healing slime covered her head to toe, her screams finally, finally stopped, and Bog and the whole staff of the hospital sighed in relief.

-----------

“You can’t go after Dawn!” Half the council seemed to shout at once.

But Dadga was the only one who seemed to actually listen to her.

“Daughter, with one princess gone, we can’t have another…”

“Go missing with no explanation? You’re right. We don’t know why they took Dawn. Someone needs to go and find out. Preferably without a massive army at their heels. That will just make the situation worse.”

The war-mongering councilors blustered, but Dagda was rubbing his brow again.

“You have a point. A diplomatic solution would be better, if possible…”

“Madness! You’ll get her killed. Why don’t you leave the goblins to people who have fought them before?” Roland said to Marianne, speaking over Dadga in such a way as to earn a few shocked expressions from the younger councilors. Then he turned to the whole table. “I can get a battalion into the goblin capitol in a week, tops. We can deal with this scourge once and for all!”

“A week? A million things could happen to Dawn by then! Give me a few days, and I can scout the situation, make contact with their leaders, and solve this all without bloodshed!” Marianne said.

“It’s too late diplomacy, buttercup. It’s time for - “

“It’s never too late for diplomacy, General. We have people - AIs - designed specifically for this kind of thing!”

Marianne waved a hand, and with a pop, her three handmaidens popped into existence and there was a collective sigh of understanding from the older councilors.

Just because one AI had gone mad, did not mean that Martians had given up upon the idea. Each of the three tiny, hovering drones had a sliver of the bio-organic computer of Mars within their chassis. They could flicker in and out of the bubble dimensions with a thought, and while they were far from fully sentient they were as smart as any of the other bio-artificial “pets” Martian households often harbored.

Of course, the AIs of the Royal household had some advantages that their lesser brethren could never dream of. Though they did not have true intelligence, they had all the bubble-gifted powers that could be replicated by science: Rose could easily take on four or five of Roland’s troops, and had acted as Marianne’s trainer when no one in the army had been willing to endanger the Crown Princess. Orchid could instantly snap herself and any master into the bubble dimension, and had the intelligence to know when to do so and a subroutine that would allow her to easily transport her charge a safe distance away from any conflict...without trapping them in stone or the void of space, as was the problem with so many other bubble based transporters.

And Lilac...well, she was perhaps the most important for this mission. With in the little bug-creature’s carapace was a connection to the ‘net stronger than any Fairy or Elf could manage. Even deep underground or far far away from a transmitter the AI could act as a constant link to the ‘net dimension. Her subroutines connected to all the knowledge of Mars, and she intelligent enough to easily be able to carry a conversation and follow complex instructions. With Lilac at her side, Marianne would have no fear of losing communication with her father or the generals. Lilac could act as a diplomat even if Marianne wanted to remain hidden, following prompts through the ‘net or simply defaulting to previously recorded diplomatic dialogues.

The three together were a perfect combination for the mission Marianne sketched out - fast, highly mobile, and capable of protecting both themselves and anyone who accompanied them.

The problem for the council - though not for Marianne - was the fact that the three were bonded only to her. Her commands were needed to control the drones, her input necessary if there were any malfunctions. And everyone could see that the smaller the group that went with the three AIs, the faster they could move and the better chance they had of making it through the underground unhindered.

Marianne threw up an AR mask to hide her triumphant smile as councilor after councilor admitted that, yes, Marianne’s plan seemed solid.

“If you want to send out the army, that’s the choice of the generals.” She continued, trying not to let bitterness or irritation endanger her argument. She should have been able to command them to hold their hand, but with Roland in charge there was little hope of that. “But we should at least try diplomacy.”

Dadga sighed. “As much as it pains me to say it, your logic is sound. A week is surely enough time to establish contact with the goblins and confirm Dawn’s safety. If nothing else, it will give us time to mobilize should the worst case scenario be true.”

Marianne nodded, and Roland sputtered.

“You can’t be serious! Sending a girl out there alone?! Myself and a trained squad - “

“Would just slow me down.” Marianne argued. “And weren’t you just saying how important having an experienced general to lead the troops would be? You should do what you’re good at, and I’ll do the same.”

Roland looked down his nose at her. “Oh? And what is that, Princess? What is a Princess good for?”

A whole Martian year later, and he still had the ability to wreck her with a look. Condescending words that had once made her feel honored to be in his glorious presence, but now stung and set her blood boiling.

But she smiled through her blood-lust, reminding herself that it was all for Dawn, and said:

“Dealing with manipulative bastards. I’ve got an amazing amount of practice.”

Chapter Text

Marianne packed quickly, lest the council get their heads together and decide that what she was doing was too risky, despite all her training and experience making her the perfect candidate. Her handmaidens fluttered around her, following her from room to room and whispering recommendations as she strapped on her deceptively thin battle armor and sword. Everything Lilac recommended she bring along was thrown into bubbles then loaded into side-bags that she hung low on her hips, tied with carbon nano-fiber cords that would be able to handle the stress of the upcoming flight.

She was examining her Martian jet-pack, looking for any damage or potential tampering, when there was a quiet cough behind her.

“Princess?”

She turned, and found Suni wringing his hands in her doorway, eyes red and hair disheveled from tugging. He still had Dawn’s train tucked into his belt.

“Suni. Come on in. Does this look safe?”

The ELF glanced at the device as it was presented to him, eyes flickering to his AR glasses. “The records say it’s been serviced within the last year. There shouldn’t be…” He interrupted himself, shaking his head. “Nevermind that. Mari, I’m sorry.”

“You should be.”

He winced, and nodded.

“But I’m also not stupid, Suni. I can tell Roland put you up to it. And prevented you from telling anyone through that virus, right?”

“Yes, but…”

“But what?”

“But I did it anyways, even though I knew Roland wasn’t telling me everything. I should have known - the Queen would have been back years ago if the potion worked the way Roland said it would. But I swear, I never thought I would hurt your mother. Or Dawn.”

Marianne set the jet-pack down and let the handmaidens flutter round it, checking it with their unique skills. She leaned back onto a force-bubble, wings flapping lightly as she examined Suni’s morose expression.

“Do you know why the Queen bubbled herself?”

Suni shook his head. “Most ELFs say it was an accident. Else why...why would she leave you behind?”

Marianne laughed sadly. “Hah. If that was the case, Father would have used the potion, danger be damned. It’s certainly happened before - fairy children making bubbles too strong, ELFs getting trapped in bubbles by cruel masters, or being stuck when a bubble creator perishes, taking their commands with them. We might not have a ‘potion’ like you found, but there are ways to unlock almost any normal bubble with minimal danger to the inhabitants, and Hazel has a whole division dedicated to only that.”

She shook her head. “Mother’s bubble is different. She placed a geas on it. Without a dissolving potion, it will only pop when certain conditions are met.”

-------

The memory came easy to her mind, along with the sharp pain that always accompanied it.

Queen Juniper, beautiful as always, even in her rage, storming away from the council chambers after another bitter defeat. Marianne couldn’t remember what the argument had been about, just another one of an endless stream of shouting matches that had grown between the King and Queen as one argued for tradition and simplicity, and the other argued for freedom and safety for all her citizens. No one had supported the Queen’s radical ideas then, and things hadn’t changed much since she had bubbled herself a half century ago.

But in Marianne’s memories, all that had mattered in that moment was the expression on her mother’s face, as the anger and hurt faded and she slumped against the wall, hand going to hide her eyes and she sobbed.

Years later, Marianne wondered if things would have been different if she had gone to Juniper then, comforted her mother and promised to help, rather than staying hidden behind a column, shocked beyond moving at the sight of her perfect mother showing an emotion beyond kindness or perfectly poised righteous rage.

Later that night, after Marianne’s handmaidens and ELF attendants had put her to bed, she had woken to find her mother sitting just past the warm glow of the protective field, watching her daughter sleep.

“Mummy?” In the darkness it was hard to read Juniper’s expression, but there was wetness at the corners of her eyes and when she leaned forward to kiss her daughter’s brow there was a sad smile on her face. “What’s wrong, Mummy?”

“Too much, my sweets.” She drew Marianne into a hug, and little girl buried her face into her mother’s blouse. The scent of crushed roses still took Mari back to that moment. “Far too much.”

“Can we make it better?” The little Marianne asked, concern in her young voice.

“I’m afraid not. At least...I cannot. Maybe you’ll have some luck where I haven't.”

“But...you can do anything.”

Juniper laughed and pulled her daughter closer. “Oh, I wish that was true, my love. But I’m afraid there is only one thing left for me.”

“What’s that?”

“Mummy’s going to go away for a while. Maybe a long, long while.”

“Can I come with you?”

“No, my dear. You need to stay here and help your father.”

This made sense to the young Marianne, and she solemnly nodded. “I’ll take care of Daddy and Dawn and Suni, too. And all of Mars! Just like you do!”

A strangled sob broke from Juniper’s mouth and she wrapped both her arms and wings around her daughter and hugged her tight enough that for a moment neither could breath.

Then she pulled herself away, and held Mari at arm’s length.

“When I’m gone, some people are going to come and ask you a lot of questions.”

Marianne, still getting her breath back, simply nodded.

“You can tell them that I’ll come back when the bubbles open and all of mars is one.” Her voice rang, lights flickering as she spoke with an inflection that commanded the computers to listen as well.

“When...the bubbles open?”

Juniper nodded. “...and all of mars is one. Remember that, my sweet child.”

She kissed her daughter’s brow again, and Marianne felt sleep take her away.

Juniper bubbled herself later that night. No one noticed she was gone until far, far too late. It had been said that the Queen of Mars was the strongest Fairy ever to be born, and her command of both fields and computers proved it. She had shrouded herself in a million different bubble-layers, solidifying over the week it took to uncover the bubble, making it near impossible to cut through. No one had thought to ask Marianne where her mother had gone, so precious time was lost, and the geas worked its way deep into the code of the Martian computer network, protecting the bubble from any but the worst brute-force methods of popping it, a technique that had been lost to the goblin-depths with the banishment of the mad AI Sugar Plum.

Queen Juniper was gone, until her geas had been fulfilled.

-------------------------

“So...you’ve never tried to unbubble her out of respect for her decision?”

Marianne blinked, memory fading and Suni’s warm face coming into view. Amazing how he always seemed to understand what she was trying to explain, even when she herself wasn’t totally certain what she was trying to say.

“That was my Father’s decision. Mother took herself away for a reason. To act as inspiration when nothing else could be done.” She sighed. “I suppose it’s no surprise that no-one outside the royal family knows of it. My father’s honor did not extend that far, and I’m sure his councilors convinced him that letting the true reason be known might start a revolution.”

“Does Dawn know?” Suni asked.

“Some of it, I assume. But you were both so young when it happened. And even I don’t like to think about it much.”

“I guess it wouldn’t have mattered either way. If I brought the Queen back by breaking her heart and burning her wings, I doubt even Dawn would ever want to see me again. Roland’s right - I am a monster.”

Bonk. Suni winced as Marianne’s fist connected with the top of his head in a light punch.

“You’re no monster. Stupid, yes. Way too eager to listen to Dawn’s orders, too. I’ve been telling you that for fifty years.” Suni flushed, and Marianne continued. “But people do stupid things when they’re in love. And try as I might, there’s no way I can get rid of that. So why don’t you start thinking a bit - about yourself, about your situation, heck, about what Dawn really needs - before just jumping right to the first thing you think will make her happy?”

“But that’s all I want…”

“For Dawn to be happy? Much as I adore my sister, living an eternally blissful life isn’t something I’d wish on anyone.” She paused. “When I get back with Dawn, and I will bring her back, you two better sit down and have a long talk about this.” She reached out and shook her friend lightly. “Your stupid crush wasn’t the problem - not talking about it and letting people manipulate you with it was. Fix that, and I won’t have to pummel you when I get back.”

Suni swallowed, and nodded.

“Good. Now help me strap this on.”

Suni hurried to pick up the jet-pack and waited for Marianne to levitate him to the appropriate height.

--------------------------

The device didn’t look much like any jet-pack a pre-fall ELF would have imagined. No turbines, no sleek fuel lines or thick heat-shielding. And no protection at all for the wearer. Just small white box, tapered at the front, opening in back, attached to a beige vest.

But the device didn’t need any typical protections. It produced no exhaust; an explosion did not propel it and its wearer forward. No, the bubble inside simply produced thrust, a push in the right direction. Everything else was taken care of by Marianne.

She cinched in her wings as Suni maneuvered the straps around them. He was careful not to touch any edges despite the difficulty. He might have seen Mari naked a half dozen times, but touching another’s wings was far, far more intimate that simply seeing a bit of skin. Only a doctor or lover would ever be so brazen to touch the physical manifestation of a fairy’s mind.

But Mari didn’t notice the difficulty Suni had, familiar with the routine of being dressed by attendants since she was small. Suni did the same for Dawn occasionally, when her maid was busy with a more finicky piece of clothing, but he avoided it lest he get distracted by the vibrant, swirling colors of Dawn’s wings. Luckily, he had no such temptation for Marianne, and the vest went on without upset.

The Crown Princess cinched the straps tight around her chest then rolled her shoulders, settling the pack comfortably into the small of her back, just below where her wings grew. Her handmaidens flew to her side, chittering, and she opened one of her packs to let them in. Each contracted into a tight ball and nestled themselves among the storage bubbles for transport.

Suni stood back as Marianne flexed her wings and commanded a window screen to open. She looked back at Suni.

“Do I look okay?” There was a slight waiver of uncertainty to her voice, and Suni felt a surge of pride - and sorely needed self confidence - that Mari still trusted him enough to drop the mask of perfect control around him.

He nodded, and she flashed him a smile.

“Good. I’ll call as soon as I know where Dawn is.” Then, impulsively, she swept him up in a hug, and for a moment they both clung tightly to each other, the fear and chaos of the past four hours rising up and threatening to crack Mari’s resolute facade, the terrible worries that came to Suni’s mind allowed to the surface, the roll of both their emotions let out, for just long enough for the other to acknowledge and offer support.

“I will bring her back.” Marianne promised.

“And I’ll do everything I can get the potion.” Suni said. And they both tightened their hold on their friend, before finally letting go.

Her wings flashed in the light of the sun, brilliant purple momentarily lighting up her rooms, before she was gone, darting through the spires and traffic around the castle, speeding towards open air and the dangers ahead.

--------------------------

“Sire?”

Bog looked up from a screen displaying reports from the goblin raid. Lists of injuries and suggested rewards danced in his mind, the minutiae of command falling upon him like so many bricks, slamming down as the adrenaline gave way to bone-weary routine.

“Yes, Cleave?”

The stocky goblin coughed. She was of one of the more common species, short and round, vaguely amphibian. Much like the recently retrieved Stuff, who Bog had high hopes for. The species seemed to keep their wits after the transformation, and it was enough of a rarity that Bog assigned most to jobs which required focus and common sense, something that most other goblins were sorely lacking. Usually they could deal with problems without needing his help.

She coughed. “It’s about the fairy, sire.”

She winced and scuttled backwards hurriedly as the King’s eyes snapped to her and his shoulder-plates raised in irritation.

“What about the fairy?”

“Well...she seems to have taken to the treatment! That’s good!” Cleave tried a smile, but it didn’t reach far before Bog’s glare froze it halfway to her cheeks.

“You wouldn’t be here if there wasn’t a problem.”

“Right. Um. Well. The treatment - the painkillers, mostly - they might be working too well.”

Bog covered his eyes with one huge hand and massaged his brow. “Is she still screaming?”

“No. But…”

“But?”

“She’s singing. And we can’t get her to stop.”

Chapter Text

Marianne flexed her wings, an action that felt somewhere between a toe-touch and solving a puzzling math problem. A stretch in the brain, but with all the pleasure that came from the physical act.

She didn’t get to let loose and fly often, her responsibilities often literally grounding her. So despite the dire circumstances, she couldn’t help but enjoy the momentary freedom.

Marianne’s rooms were high in the castle, far above the audience chambers and public spaces, higher even than Dawn and her Father’s suits. It had nothing to do with status, and little to do with her responsibilities as Roland had effectively convinced the world that she was in charge of defense in name only. Another Crown Prince or Princess would have lived even higher, closer to the shield generators and observation platforms, always a moments flight away from the elevator connecting the palace to on of Mars’s many space stations. Now a minor military attache did the work of monitoring such things, and likely did a better job of it that the busy Marianne could, but it still rankled.

Still, the view from her rooms was stunning, and the air around her window was clear of the normal flight traffic. Far below other fairies flew, or ELFs on dozens of different kinds of insectoid transports. Half mechanical, half organic dragonflies buzzed around the public areas of the palace, their maneuverability and speed making them perfect for taxis, while millipedes a thousand times the size of their earth counterparts with hollow interiors acted like trains for hauling large quantities of goods.

Marianne took note of the healthy bustle of the castle, then tightened one set of wings around herself, easing into true invisibility. Dawn and Suni might prefer to hide themselves from prying eyes by simply throwing up an AR shield, but Marianne prefered the more complete safety of hiding from light itself.

Admittedly, not many fairies had such control over their fields as to warp light completely around their body. And fewer still could use other abilities at the same time. Being of royal lineage had its perks. Marianne hovered easily as she looked over the palace, invisible from all but the most clever fielder or tech-wizard.

Within her AR, her handmaidens buzzed around her; Rose looking for dangers, Orchid testing her connection to the ‘net, and Lilac offering up the most important piece of information - a suggested map to their destination.

The flight would be long, taking a wide curve from the upper plains to the hypothesized location of the goblin city far to the south. The curve was necessary, taking them almost an hour off course but was necessary to avoid the crystal that sat squarely between the old pre-terraformed martian settlements and the current Fairy lands.

Lilac’s plan was good, and Marianne wheeled and set off to follow it, moving outside of the more populous areas before engaging her jetpack.

It took only a few minutes to fly beyond the main palace grounds, her route taking her over the military barracks just to the south. It was a hive of activity, the skurry of ELFs and Fairies alike looking like ants from the distance Marianne saw them. Roland had gotten his way: the army was preparing to march on the Goblin capitol. He wouldn’t even wait for her to report back, and likely had convinced the generals that she was a lost cause, in need of rescuing as well. Lies and violence, the only two things he did well.

The thought made Marianne glare, and her control wavered for a moment, confirming that the army had no one watching the air. Plenty of goblins had wings, presumably some of them could become close to invisible and do aerial reconnaissance. Roland should have had someone watching the skies for the tell-tale shimmer of warped light. But no one looked up, much less hailed her to request identification.

Marianne shook her head and continued on her way. The army was...sloppy. That was the nicest word for it. Dull would be another. They practiced techniques that were 2000 years out of date, missing the way fields and AR could change the nature of war. If Goblins could slip into the palace and kidnap a Princess, what else could they do? And if she could see everything the Army did from above, how secure were those vaulted military tactics Roland was always bragging about?

It was a grim thought to wonder about how the army would do should they encounter an actual war, against motivated opponents. Marianne was certain the goblins would defend themselves should the need arise, and she wasn’t confident her forces could win under Roland’s leadership. There would be terrible bloodshed on both sides if her mission didn’t succeed.

With that thought turning over in her mind, she flapped her wings and pushed herself beyond the army grounds, and on out into Mars proper, worry speeding her wings as well as her thoughts.

-------------------------------------

It was another hour before Bog had a chance to to visit the Fairy girl again. He had been away from the goblin city for a week, inspecting their defenses, retrieving more goblins from the Bubble repository, and then dealing with the fallout of Plum’s potion. Though most everything in the goblin city ran on automatic there were still people involved, and thus ruffled feathers to sooth (or in Bog’s case shout down) and tensions to ease.

The problem was that there was always just enough, and rarely any extra. Just enough food. Just enough medicine. And of course everyone wanted their families back, but every addition to the city’s population had to included in their budgeting. And there were always unexpected accidents and losses. Bog was already worried about the addition of another troll-like goblin to their ranks, the huge creature needing to eat his own weight in protein every day. All goblins did better on meats, but the hydroponics systems of Old Mars simply were not equipped to handle the nutritional needs of carnivores. For every Brutus brought back, three other goblin families had to wait another year for their loved one’s return. But it wasn’t as if Bog could send a goblin back into their bubble simply because they were too big. For all his fierce demeanor, he wasn’t that cruel. So Anthony joined their ranks, just like Stuff and Fizz and Chen Lu.

So the first thing he did upon returning home after a week of rambling was to read all the reports; tons of food produced by the hydroponics bays, hectors of cavern discovered or reclaimed, liters of water stolen from the fairies, oxygen levels throughout the underground, and on and on, every different number a weight on a scale that could tip the whole underground into chaos, or free them to finally accept more into their number.

Bog claimed to avoid the goblin city for this very reason, though the true reason was waiting for him when he returned to the hospital.

“Bog!” An ancient orderly rushed up, bright white uniform harkening back to a style that hadn’t been seen in over a thousand years. The face that she could wear a skirt that short without any hint of shame belied everything Bog knew about Earth medical practices.

“Mother. I thought you were overseeing the clinics in the East.”

She beamed, and wrapped her stumpy arms his waist, as high as she could reach. She was one of the smaller goblin sub-types, coming out of her bubble with a short, humanoid stature and thick horns covering most of her head. She had never developed wings - very few humans ever did - but her whip quick mind had not dulled the slightest over her transformation and the intervening centuries. Once a simple nurse orderly, one of thousands in a huge New York hospital, now she lead all the medical facilities that served the underground.

Given how often goblins got injured, either from their own stupidity or the danger in their everyday lives, she was just as busy as Bog was.

Or should have been. But there she was, chattering a mile a minute, praising him for bringing home such a fascinating specimen.

Or, as she called it, “a perfect catch.” Bog felt his headache returning even before he saw the girl again.

------------------

Mars shimmered from above. A teal blue sea stretched out below Marianne, an endless expanse of green, wind rolling through and sending sparkles towards the stars.

But there was no ocean on Mars. It had been blown away a billion years before humanity even existed, the weak magnetic field of Earth’s sister-planet evaporating as its core cooled and slowed, leaving it victim to the solar winds that carried away air and water alike, blowing everything needed for organic life out into the void.

Most every drop of water on Mars was pulled back from that very same void: frozen ice towed from the asteroid belt by small space craft then loaded onto space elevators and sent down to the planet. It was a costly process, dangerous as well for the Martins who navigated the belt searching for ever more water to send home. They imported Atmosphere, too, though that mostly came from Venus, the greenhouse gases needed to cocoon the planet and form a protective cover eternally added to the thin Martian atmosphere, undoing the stripping of the planet caused by eons of solar wind before humans re-started the core to aid in their terraform efforts.

So Water was precious on Mars, not enough to be rationed, but certainly in far too short a supply to waste on something like an ocean .

Instead the sea stretching below Marianne was a forest, half artificial trees growing kilometers high, dwarfing everything around them, each glass leaf painted with photosynthesizing algae that both cleaned the Martian air and provided power to the whole planet. Each leaf was no bigger than her hand, and they were only tinted blue: it was possible to see through hundreds of stories of foliage almost like a real ocean. And beneath the boughs of those trees whole cities flourished in eternal twilight, ELFs living out their entire lives serving trees that held up the very sky itself.

But Marianne did not dip beneath the wide branches or try to catch a glimpse of the hurrying inhabitants. Instead she flew above even the tallest trees, so high that she brought her own oxygen with her, hardening her fields to near impenetrability and rebreathing the air she had gathered back in the palace as she skimmed above the endless sea of foliage. Few ELFs could survive at this height, the atmosphere too thin. Some Fairies brought pleasure craft up here, to surf the wind currents and enjoy the spectacle, but just like Mariane they brought their own oxygen, usually in the form of tubers harvested from the insides of the giant trees, a single cell swelling to hold a whole day’s worth of oxygen.

Marianne moved far faster than any of those vehicles could manage, shaping her fields into a point in front of her and letting her thruster push her ever faster forward. In a thicker atmosphere she might have left a sonic boom behind her, but in the thin air of Mars she moved with just a whisper. It took concentration to maintain her fields, remaining invisible while also commanding physical field to hold her air, and managing the shield that eased them through the thin air and allowed the jet-pack to do its work. All the while making sure to steer around obstacles and follow Lilac’s map.

She would traverse half of Mars in a few short hours, all on her own power.

Beat that , Roland , she thought to herself with some satisfaction. Who’s a useless princess now?

-------------------------------

Just as warned, the girl was singing, but not in any language Bog knew. Her high, wavering voice filled the Wing Ward, the other inhabitants groaning every time she hit a high note. And she could sing very high, her vocal range shifting into the hypersonic, making Bog quite glad that they had no dog-like goblins currently growing wings, else they might have had a riot.

His mother, Griselda, was chattering animatedly as they approached the girl; so far she had spent the most time with the fairy, her general tone-deafness for once finding a use. Her information was not the least bit useful to Bog, mostly extolling the various virtues of the girl in an unsubtle attempt to convince him to see the girl as a potential mate rather than a captive.

He let her prattle on until they reached the door to the girl’s room, then turned on her.

“Mother. I’d like to remind you of what I said last time you tried to set me up with someone. What was my one rule?”

Griselda paused mid-sentence, her mouth snapping into a disappointed pout.

“...you won’t date anyone who screamed at the sight of you.” And if she had remained silent, they likely would have avoided a later row. “But really. Don’t you think that rule is a bit too extreme? You can’t expect most girls to…”

Bog paused before the door, claws cutting into the door frame. Too extreme . For anyone else, it would never even be considered. But he was hideous, a monster made flesh, and to look upon him unprepared always had the same result - tears and screams. Even women warned of his appearance flinched away. Even goblins sometimes shuddered when they saw him. And how many times had he opened a bubble, helped someone into the light, only for them to get one look at him and flee in terror?

No. He had set the bar too low, if anything.

“And anyways, how do you know she was screaming at the sight of you? It could have been the pain, or the shock, or any number of …”

He pinched his nose and reminded her. “Two hours mother. She screamed in my ear for two hours . I am not making her my wife.”

Griselda’s eyes gleamed. “Don’t get so cocky, boy. You haven’t met her yet.”

“I don’t see how that will…”

“BOGGY!”

The singing snapped out the instant Bog opened the door, and he was greeted with a smile so bright it nearly lit the underground.

The fairy girl was sitting on a medical bed, hands outstretched as if she had been conducting a symphony in time with her song. Perhaps, in her mind, she had been. She wasn’t restrained, though her legs were tucked into a hospital blanket. Griselda or one of the other nurses must have taken pity on her, as glowing mushrooms and other lights brightened the normally darkened room enough almost to rival the surface sun. Across the room was another open door, and goblins skittered around it - children, mostly, come to visit their parents in other wards and taking the time to sneak in to get a look at a real live fairy. Most had never seen one before.

The girl didn’t notice any of this, and it was easy to see why. It was the same reason she did not need to be restrained.

Behind her, completely engulfing her wings and mooring her to the floor, was a giant bubble of greenish liquid. Bog knew from personal experience that it was filled with diluted painkillers in equal parts to the psychiatric drugs needed to repair Potion Burn. That the girl was awake at all was a surprise - most goblins or ELFs burned by Plum’s potion spent most of their recovery time sleeping. They needed to regrow parts of their minds, after all.

But the goblin doctors had never been faced with a full-blooded fairy before. Clearly they had erred on the side of caution, and given her enough drugs to dull the mind of a goblin twice her size. But instead of knocking her out cold, she was high as a kite and singing .

At least, she had been singing, until she saw Bog. Of course Griselda had told the girl of him. Probably his mother hadn’t stopped chattering the entire time she cared for her. There was no telling what the fluttery creature now thought.

He sighed as he summoned a chair and sat down next to her. “Bog. My name is Bog.”

She smile again, eyes twinkling. “I know! Boggy Woggy Kingy Wingy! My hero !”

“Your captor . Do not take my assistance as anything but momentary pity. Now that you are here, you will have to answer for your people’s actions.”

She blinked at him, clearly not understanding a single word. He tried again.

“My name is - “

“Boggy!”

“Bog. And you are?”

She drew herself up, then winced as her instinctive attempt to flare her wings sent shooting pain to her mind. But she rallied a moment later, words falling from her mouth so easily that she must have said them a million times.

“I am Princess Dawn of Mars, First in Kindness, Leader of Light and Laughter, Duchess of the High Courts, Mistress of the Castle and Caretaker of all Mankind, Second Princess to the Throne of Mars and eternal ally to all in need across the Galaxy.” She bowed deeply in her seat, then rose again, the stiff formality of her titles evaporating as soon as it appeared, beaming smile returning to her face. “But You can call me Dawn. All my friends do!”

Bog carefully closed his mouth. Already his mind was whirling with the girl’s revelation, desperately hoping it wasn’t true. But there was no doubt that she , at least, believed her words. And if there was even a chance …

A quick query to the underground’s darknet was all he needed. The girl looked exactly like the Princess. The titles matched and they’d taken her from the very stage of Mars’ monarchy, the Queen’s Chamber. What she said was almost certainly true.

Bog had kidnapped a Princess.

Dawn saw the growing horror on his face and surged forward, grasping his huge hands in hers.

“Don’t be sad, Boggy! I’m so glad you saved me! I’ve met ever so many nice people here. There’s Griselda and Patricia and Edwin and Brutus who says I’m very pretty but he won’t eat me and I’ve got so many plans for this place and I can’t wait to tell Mari and…”

He jerked away and snapped his head towards his mother.

“She can’t contact the outside world, can she?”

Griselda shook her head. “The Dark Net is secure. But I don’t think she’s realized it yet.” The goblin city had full access to the public AR net...but nothing from inside the city could leave. They were a dark hole on the AR map, and dozens of goblins worked hard to make sure that continued. Should their blackout ever break, the fairies would be on the city as fast as their army could fly.

Though, that might very well happen anyways given that they had captured their beloved Princess.

“And I’ve been thinking about a winter wedding, I’ve never planned one of those before, and aren’t these colors just perfect ?” The girl was waving her hands, clearly doing something in AR, but Bog didn’t have time to pay attention to her. Suddenly there were far more important things to care about. But first...

“Mother, did you know who she was?”

“Well, she did say she was a Princess…”

“Mother! We’re all in danger! And you were thinking about getting me a date ?”

Bog turned on his own AR, putting the underground on high alert with a single command, his mind whirling. With any luck, they didn’t know where the Princess had gone. Maybe if she healed fast enough, they could return her without any bloodshed...but no, Roland was in charge. He’d never let them get away with that...so they were in for a fight. But the underground had prepared for an invasion for years. With the right strategy...

Plans spun in Bog’s head, but he took the time to pat the girl’s hand.

“Don’t worry, Princess. We’ll get you home safe and sound.”

Any ally in this was a good one, he thought. But her next words chilled him to the core.

“But I don’t want to leave ! We’re going to get married ! That will solve everything !”

Chapter Text

All around the castle rumors buzzed. Everyone knew someone who had been at the party, in the throne room, when the disaster struck. What actually happened was up for debate, but all the castle ELFs knew two things: First, Princess Dawn, their beloved, sweet summer child, had been taken by the goblins. And second, Suni Dai was to blame.

Suni swallowed heavily and peeked out into the main hall. He’d never seen it so busy: everywhere there were clusters of gossiping fairies and hurrying ELFs. The high ceiling was full of flying fairies, all in army green, while beneath the floor there was the rumble of huge earth-moving insects being woken from their slumber and moved out.

Everyone, it seemed, was working hard to rescue the princess. And the man to blame was off on a wild goose chase, traveling in the exact opposite direction.

The goblins had been clear. Return the potion and they would return the Princess. Just as Suni set out, the royal house received an encrypted notice reiterating the goblins terms, proving that they had figured out who they’d taken. King Dadga put on a stiff face for the council but Suni knew he was horrified at the news and worried more at the war apparently needed to get her back.

The thought of Dawn captured and held against her will gave Suni the boost to pull his invisibility shield tight around himself and venture into the throng.

First he returned to the scene of his crime, following the crowds to the Queen’s Chambers and slipping past the AR police line as if he belonged there. Perhaps he did, though he really didn’t feel like it.

The woman he was meeting stood on the dais, for a moment silhouetted by the lights of the technicians that scurried around her. Her high, pinched features matched the sickly green wings that flowed behind her, and it was no surprise that the ELFs that answered to her seemed completely terrified. Suni certainly felt the same.

Lady Elizabeth Varanus was a scientist attached to the Bubble Research Department, one of the hundreds of fairies and ELFs that studied the science of fields and bubbles. She was neither the most renowned nor prolific; in fact most of her work was highly classified. Suni had no idea what she really did. But he knew she was often seen with Roland, and that alone made him equally as terrified as her assistants. He pushed his glasses high up his nose and bowed deeply when her eyes glanced towards him.

“Lady Varanus?”

“Suni. You’re the cause of all this mess, correct?”

She looked down her nose at him, and he swallowed heavily. Around them the technicians shuffled as far back as they could.

“Ah...yes, ma’am. The goblins were very angry that I took the potion.”

“Hmphf. They have no more right to it than anyone else. Hypocrites, all of them.”

“I got the impression that they had no intention of using it. Plum said -”

Elizabeth moved, faster than Suni thought imaginable, suddenly before him, face mere inches from his.

“You spoke to her. The Sugar Plum. You will tell me everything about her.”

Suni gulped again, her sickly yellow eyes seeming to moor him to his place. This close, there was a pale green tinge to her skin, and he suddenly decided he didn’t want to know what she looked like without AR. He had heard she was centuries old, and the vicious intellect in those eyes only proved it.

“Wh-while we’re on our way to the awakened fairies, then?”

She searched his eyes for a moment, perhaps surprised that he’d spoken at all, though her emotions were impossible to read through her mask-like AR shield. Perhaps she was planning revenge for Suni daring to show an ounce of backbone around her. But then, just as quickly as she’d come, she released him and stood, all one fluid motion, hands going to smooth the lines of her perfect suit.

“Very well. Three elders were de-bubbled on this floor. We will start our search there.”

-----------------------------

The first few fairies were exactly what Suni expected. Minor nobility or family to council members with offices on the ground floor. The first three had been released more or less in a straight line, though of course it would take someone with a true map - or the ability to turn off AR - to realise it.

“How dare you call me back before my time!”

The first office they entered was that of an assistant to Cedar, a young woman who oversaw the council-fairy’s affairs while he traveled the fields or dealt with his home farm. Currently she was being berated by a man that looked near identical to her, except for the notable lack of silver wings. Around them the room was in disarray; desk overturned, soil samples and seed scattered all across the room, half a dozen storage bubbles burst open and discharging rapidly growing foliage, the scent of growth and decay overpowering. Perhaps it wasn’t a surprise that the man held a sneer on his face, as if he smelled something foul. However he was turning said expression on the clear owner of the room.

The woman - Ashbury - was attempting to get a word in edgewise, to no avail.

“Papa, if you’d just listen…”

“Look at this! You live in filth, like I always said you would. What are you? A dirt-grubbing nobody? A farmer? No better than an ELF, just like - “

The woman’s lip quivered, her normally tall frame wilting in the face of her father’s haranguing.

“Mister Ashbury.” Elizabeth strode into the chaos, wading into the dirt and distress with equal disregard. Suni hurried behind.

The man glanced aside, clearly ready to continue to berate his daughter as soon as he dismissed the interruption, but stopped when he saw the AR insignia declaring Dr. Varanus a bubble tech.

“You! Tell me why I’ve been returned before my time!”

“A mistake, Mr. Ashbury. One we will rectify with haste.”

The sneer eased off the man’s face. “Good. I will not spend a moment more with this disappointment.”

The woman looked away, but did not speak out. Perhaps she would be as relieved as her father would be when he was gone. Though she had been keeping his bubble on her desk...perhaps there had once been some love between them, despite the current feud.

“Very well. I will return you to a bubble.” Elizabeth waved a hand, documentation appearing for her eyes only. “Please relate your opening conditions.”

“I want to return when I have a daughter I can be proud of.”

Elizabeth’s hands paused in their motion. “You will need to be more specific than that.”

The sneer returned to the man’s face. “It was enough for my bubble.”

“I’m sure you believed so, but I would not wish to imprison you longer than necessary. The Repository cannot in good conscience assign bubbles that cannot be opened.”

The man seemed about to say something biting, but catching sight of Elizabeth’s narrowed eyes was enough for him to quickly reconsider.

“Hmm. Then I will return when my daughter has found a career equal to that of her position.” When Elizabeth gestured for more he added, “Equal or above the level I achieved in life, SL-15.”

At this, the woman started, eyes going wide and mouth opening to say something...only for Elizabeth to easily speak over her.

“Very well. That meets all our criteria. Please stand back, Mr. Ashbury.”

The former fairy did so, his daughter watching helplessly, as Elizabeth touched the silver bracelets on her wrists, her connection to the ‘net flaring the room around her as the protocols Ashbury had set were tied to the bubble she was creating.

She placed her hands apart, and Ashbury stood taller, taking the stance he must have been in during his first bubbling. As the Doctor moved her hands inward darkness swirled around him.

Then, with a clap of her hands, he was gone, and a black bubble, only the size of a fist, remained in his place.

Elizabeth nodded to herself. “That’s sorted. Come along Suni. We have two more cases on this floor.”

“But - “ Both Suni and Lady Ashbury spoke at once, but Elizabeth was already striding out the door and Suni had no choice but to follow in her wake, leaving the destroyed room and the distraught woman behind them.

“Hurry, ELF.” She said.

“Doctor Varanus - “

“I said hurry.” And she caught hold of Suni’s jacket and tugged him forward, faster.

“But - Lady Ashbury is registered as a Social Level ten. That’s leagues above her father…”

“Suni.” The Doctor’s tone could have frozen stone, and her yellow eyes held high contempt as she glanced down at him. “How long does it take for the Martin Bubble Repository to update bubble information?”

He glanced at his AR, feet carrying him at a half-run after the fairy. “Uh - about half a minute?”

“Exactly.”

Behind them there was the sound of sudden, out-rushing air and further things crashing. But they turned a corner a moment later, moving from the well-lit corridors of office to the darker servant’s halls, and so Suni nearly didn’t catch the expression on Dr. Varanus’s face as she heard the commotion.

Satisfaction.

Specifically, the kind of wicked satisfaction that lit her yellow eyes and turned her lean face into a mask of cruel glee, something wicked watching the chaos unfold around her with immense joy. In that instant, she looked as far from human as an AR mask would allow. And Suni swallowed, and forced his eyes back to the ground, hurriedly pulling up their next case.

Who - what - had he been assigned to?

------------------------------

There was little more in the world that Marianne enjoyed more than flying. The rush, the swell, the pulse-pounding acceleration - all of it spread a smile across her face no matter how dire the circumstances.

Maybe, a cynical part of her self thought, it was because of the dire circumstances that she enjoyed it so much. Fly fast enough and it seemed as if one’s problems could be out-paced, left behind in the dust, stranded by a gravity that she could outrun if only she let herself go.

Or maybe it was just the novelty of it. So rarely did she have time to herself, and far rarer that she could set aside her worries and simply focus on the rush. In the back of her mind her destination loomed large, and behind her was chaos and Roland and a world trying to bend her into a mold she could never fit.

But in this instant, on the planes between here and there, it was just her and the lonely wind. After she passed the ocean of trees, Mars devolved into arid desert, not so different than what it must have looked like two thousand years ago, before the terra-forming began. What once had been farms and ranches had faded back into the dust from disuse, only the hardiest - or most mutated - plants remaining.

The only true difference between Mars of old and now were the Mushroom cities. They could be seen from leagues away, their crowns popping above the horizon as if they were still growing as she approached. They stretched out across the plains, dotted here and there in a logic that had been half-grown, have dictated, roads growing like feelers only after the little city-spores had thrived long enough to be permanent.

She stopped at one of the first she passed to refill her oxygen, slipping through the fraying shield and into the cool darkness of the ancient city, keeping to the edges and staying only long enough to catch her breath and fill her stores.

The cap that stretched above her was four kilometers in diameter, not tiny, but far smaller than the largest of the old cities, and safer as well. Even Marianne wouldn’t risk pausing beneath one of the huge domes, only kept up by degraded technology that hadn’t been serviced for centuries, nature taking its course and the caps flattening, tearing their delicate membranes in the process and raining down destruction below as they crumbled.

The mushroom cities had been intended to last for centuries, and they had done their duty well, acting as hubs for the frontier of Mars in the time before the permanent terra-forming was successful, back when unfiltered atmosphere was still imported from Venus and the poisonous gasses fed plants even modern Fairies would find strange. The caps had remained standing, even as they went from the only above ground settlements, to homes for most of the population of Mars, to dying frontier towns, to creaking, abandoned monuments as Mars moved Up and East. And yet still they breathed oxygen for the beings beneath their bows, and would for as long as even one portion of the cap remained, fulfilling their last half-forgotten duty.

Marianne rested atop one of the honeycomb houses just inside the nameless town's shadow. To a non-native the whole city was mad to behold, full to the brim of near identical homes stacked ridiculously high, no differentiation between one family’s home and the next, alley-ways winding around and over and even through the comb houses. The order must have made sense to those who lived there, but the logic had been lost to time, age fading whatever identifying markers differentiated a shop from a house from a school all back to a uniform amber.

The only hint of once-human life was the bubbles; indestructible to time, so tiny storage racks could still be seen in some of the combs, left behind and forever closed as their initial creators had moved on to other things. Unneeded flotsam left behind by humanity, immortal by dint of being forgotten.

Marianne tried not to think too hard on it, those dark bubbles left behind in a dying city, but the whole area whispered with melancholy. Like with so many other things on Mars, the whole structure of the mushroom city was half organic, half metal, the code of the initial organism altered to grow as steel and iron woven in with mycelium and fiber. Well built, even though it had long outlasted its use.

Marianne shook her head free of the thoughts and instead stretched out her wings. There was a line in her AR stretching forward and she could not spend too much time resting.

Lilac popped into existence beside her, chattering at the delay, multi-faceted eyes flashing with curiosity and wings humming. She was unaffected by the history of this place, wide eyes simply taking it all in.

She cocked her wise little head, noting a new source of information, and darted towards a terminal on the honeycomb’s side.

Marianne jerked forward, catching Lilac with a soft hand and a impervious shield.

“Careful, pet. Even you wouldn’t be able to help it.” She pulled the AI back to her, away from the terminal and the direct connection to the town’s over-net. “I’m sure it went mad long ago.”

There wasn’t any question of it, really. All the old cities were mad now. Worse even than the underground, in their way. It wasn’t the illusions that were dangerous here, but the whispers, always on the edge of hearing, ELFs and Fairies enabled with AR instinctively picking up the disease that had struck down the Mushrooms long before time had done its work.

Lilac chattered unhappily, feeling the wrongness all the more strongly and her innate desire to fix thwarted by Marianne’s hands. The little creature could hardly realize just how close to danger she had come, and just how pointless her attempts to help would have been.

The Mushrooms had been innovative in every way when they had been grown, each a little different, packed with whatever new technology had been created since the last spore had sprouted, cutting edge solutions thrown into the mix without too many thoughts to consequences, all added onto a structure that seemed genius. The corded fibers that connected every house, every light, every cell in the giant structure made a primitive over-net, moored to reality and biology but glimpsing the future potential.

Unfortunately that biology had lead to its downfall.

The disease - or disorder, depending on how close to human cognition one considered the mushroom’s overarching programming - was called Deja Vu, and that was why Marianne kept Lilac tight in her hands. The little AI likely would not become infected, and of course the modern over-net had no difficulty ignoring the bogus signals from the Mushroom cities, but it paid to be careful.

Deja Vu. The concept must have made sense to the ancient Fairies and ELFs that had first encountered the problem. But modern fairies had no concept of it, so used to splitting their vision between two, three, even dozens of inputs.

Suni had explained it, once, as a “moment of absolute certainty that one had experienced something before, caused by a momentary discongruity in relaying information from the eyes to the brain”. The same exact sight, received a moment apart, tricking the brain into a false sense of familiarity and subsequent confusion.

Dawn, as mystified at the idea as Marianne had been, but far more familiar with the games of children, had called it “Modern Telephone”, and explained how information could be distorted as it passed from one receiver to another, giggling at the image of a towering structure like a Mushroom City brought low by a game every child could play.

But the results were far from funny. Within the over-nets of the caps, every break in a connection could result in a moment of Deja Vu , in which two different sensors relayed slightly different pictures of the same event, confusing the over-net and leading to different systems acting on different information. In the beginning faults had been slight enough, and repairs quick enough, that conflicting data did not corrupt the system unduly. But as people left, whether because of better prospects to the East or because they could not trust the structure that - quite literally - prevented the sky from falling, repairs and maintenance became less and less frequent. More and more fractures occurred, breaking the once towering ego of the single Mushroom into tiny and tinier pieces, often half at war with themselves, devolving into true madness faster than anyone could have anticipated.

And now the old Mushroom cities were quarantined in all but name, the early AR they gave off so maddening that anything with any connection to the net couldn’t stay long. Even animals stayed away, the buzz of the warring AIs audible even to those with no AR at all.

And to Marianne…

The voices were faint, just on the edge of hearing, the lack of power and purpose whittling them away into all but the simplest protocols. There were just so many of them, whispering on the wind, voices mingling and mixing, only rarely a word coming clear enough to rise above unless she focused hard on something close.

Beneath her feet the house AI muttered to itself, sleepy sensors babbling on:

Sun dark cold work no think breath make do not same same same not flutter wings ?master? not help make do breath help good yes/no help make happy smile do more smile ?friend? Leave don't leave gone sun dark work do make breath...

Each of the hexagonal rooms below her had a similar story, sensible enough by itself but doubled, tripled, and on, and they turned into a roar.

Sad. But there was nothing Marianne, or Lilac, despite all her skills, could do about it. So the fairy princess stood, stowing her AI companion away, and set out once again. Onward and outward.

------------------

“Sire?”

Bog groaned, and forced himself upward. He had almost - almost - been able to close his eyes for ten minutes.

The ice-pack he’d dropped on his pounding head slipped to the floor, ignored, as he turned to stare at Thang.

“Yes?”

The small goblin tried to back up, but ran into his partner, who looked curiously beyond the door. A whispered conversation started, which Bog quickly interrupted.

“Why are you here Thang?”

“Ah - news from the Mushrooms, lord. You had Silk and Burr listening for warnings of the army?”

“Yes. And?”

“And they sensed a Bird.”

Bog’s normally stony expression became bedrock. “A...bird.”

Thang swallowed. “Well, you know how it is, Lord. The Mushrooms don’t really make much sense…”

“What kind of Bird?”

“Well...it might not even be that. Just something small, and fluttery. Probably looks like a bird, at least?”

Bog’s expression fell from bedrock to lava, something that had only recently been seen on Mars again.

But no volcanoes were forthcoming, ether for the planet or the King, and he just sighed and scratched a palm across his craggy face.

“Fine. A bird. Wake me up when they report on ants.”

“Wh - “ But the door hanging was already falling back into place, the leader not even making the effort to add the sound of a slamming door, showing just how done he was with Thang’s report.

The little goblin was left staring perplexed at the moss before him.

“Ants?” He asked to the door.

But Stuff snickered. “An army. That’s what something big would see, right?” Her grin widened into a sneer. “An’ we’ll squish ‘em like ants, too!”

Thang glanced back at the door, remembering the pale sheen to his master’s face, and the worried pain in his eyes.

Then he put on a big smile for his beloved. She couldn’t see his doubt. Not after they’d been finally reunited, and were finally given everything they’d wanted. Fate wouldn’t take that away again, would it?

“...right. I’m sure we can take ‘em!”

--------------

Chapter Text

The crossing of the great plains of Mars took Marianne another hour, after her short break. She flew high and held her invisibility firm, avoiding the remaining Mushroom caps with wide, looping arcs. Now civilization, as ELFs would know it, was beginning to appear.

As Marianne approached the giant cleft in the Martian surface that the humans had called the Valles Marineris, and the Martians just called The Trench, cracked geodesic domes and crumbling black roads could be seen. Marianne winced at the sight of it: most Fairy technology had little unintended impact on the world around it, but there were poisons seeping into the soil even now from those roads and - even worse - the underground factories that littered the area.

It was the same casual disregard that Roland showed so often, though he had far less excuse than the early Martians who had merely been trying to survive without Earth to support them. Still, the sight of the roads reminded her of the carefully constructed smile on her once-beloved’s face, and the way in crumbled into cruelty if the illusion ever wavered for a second.

Instead, she set her sights on Olympus Mons, the center of the early Martian world, the site of their first space port, and the most logical place to start her search for the Goblin Capital.

---------------------------------

Suni and Dr. Varanus’s next case was far simpler than the first. A huge fairy had taken up residence in one of the servants’ halls. A bevy of ELFs surrounded her, each one carrying a tray laden with all kinds of food, glistening pies to full roasts to cool parfaits in fluted glasses.

The woman only stopped her eating when she saw Elizabeth’s AR badge.

“Atch. Took you long enough. I’ve been brought back to soon!” She complained, in between shoveling slivers of candied apple into her maw.

“Lady Redfield, our apologies for this error…”

“Do you know how long I’ve been bubbled?”

Elizabeth’s eyes flickered, calling up an answer on AR. “Three cen- “

“Three centuries! And not one truly new dish! How am I to defend my title as the Ultimate Foodie if you have done nothing to better the culinary world?!”

“I’m afraid there is nothing I can do about that, Lady Redfield. However, if you wish to return to a bubble…”

“Bah! As soon as my wings grow back, you can be sure I’ll be gone. But first I must regain my weight. That bastard Tedi stole my record and I won’t stand for it, you hear?!”

Elizabeth blinked once, then waved a hand to add this information to her notes. “Very well. Should you need assistance throughout the regrowth process…”

“I know who to call, yes. Now be a dear and get that Imp before it causes more trouble!”

Elizabeth nodded, and moved on, leaving a line of servants, all bearing trays, to take her place. But Suni paused, a thought working through his mind.

“Um. Lady Redfield?”

The look the fairy gave him was almost identical to that of Mr. Ashbury. Disdain and irritation at being interrupted in one. “What is it, ELF?”

“It’s just that...you’ve only ordered Fairy cuisine.” He rushed to explain before the disdain on the woman’s face could worsen. “Princess Dawn says that culinary innovation comes most often from those with little left to lose - the hungry and the poor, mostly. If you want something new...maybe ask for ELF or goblin food?”

The woman’s brows knit, as if she was considering the first new idea she’d had in a long, long time. And as Suni hurried away, he heard Redfield clamoring for someone to bring her a goblin chef.

He wasn’t completely sure, but Elizabeth might have smiled at that, too.

--------------------

The easiest, and most frustrating, part of Marianne’s journey began the moment she touched down on the canyon-edge just to the west of Olympus Mons.

She called Lilac and Rose out, the little AIs jumping into reality with such vehemence that Marianne could only guess that they were as eager to get started as she was. Before the two set out she reviewed their commands, ensuring that their programming would not falter while on their mission.

Then she sent them out, and forced herself to wait.

The AIs sped towards the most likely entrance to the Underground: the massive doors to what had been the first hotel on Mars, begun by Marianne's own ancestors. Now all the meter-thick glass windows had been shattered, and the airlock doors were rusted open, but one could easily imagine what the entrance had looked like in its heyday, two thousand years before. The pictures and videos were still there, preserved on the over-net, though only children doing history projects ever looked so far into the past.

In the earliest pictures everyone needed to wear space-suits and what would become the hotel was just a hole blasted into rock, not a single other airlock to be seen in the whole canyon. In her mind’s eye Marianne could identify each early hero by name, though years and mutations had stripped most everything they might have had in common away. Later images, of the hotel at the height of the tourist trade, before the crystals and the fall of Earth, showed the full staff standing just inside the windows, rows and rows of entertainers and scientists in equal number, the head of it all dwarfed by those around him.

Her ancestor did not stand out in a crowd. His companions, a blond and an wizened old scientist, drew the eyes far easier. In comparison, his dark complexion and slight paunch made him look more like a friendly bartender than one of the first men on Mars. Perhaps it was no surprise that he had fallen into his legacy by accident, surrounded by brilliance that far outshone his own. But his warm smile and the mischievous excitement in his eyes were intimately familiar to Marianne.

She remembered that look on her own face, as a child, the world still full of wonder and confident that she could take on any problem, before the weight of the world had pushed her back down to the ground. Roland had tried to train her out of it, that wild look in her eyes, hinting that she looked unsophisticated and arrogant, encouraging her to practice ‘demure’. She’d never quite succeeded, finding her struggle to hold back the one rendering her incapable of faking the other. Now when she glanced in the mirror her eyes just looked tired, neither kind of innocence likely to return.

But that was not what was most familiar in those photos. No. Marianne could trace her ancestry through mischief. But that smile, the one that had drawn thousands of people across space to one of the most uninhabitable places known to man...

It was Dawn’s smile.

She had to get it back.

--------------------------

The third stop took Suni and Dr. Varanus to one of the other famous bubble monuments in the palace. Obviously, the room was less grand than that of the Queen’s Chamber, but still massive. Two giant figures stood opposed, forever commemorated in bronze, their swords flashing silver in the wane light of Mars.

It was a room Dawn’s courtiers often took her to, so Suni didn’t even need to read the inscription or the AR to recognize the man who had re-appeared, bursting from the bubble that had been the centerpiece of the grand monument.

Baron Caramel, he of refined charm and dashing looks, whom all of Mars had swooned for. And all who mourned his bubbling knew the reason: for when his family had finally forced him to choose a spouse, his greatest enemy, the knavish Admiral Cardinal, had chosen to pursue the same woman. So great was their families ire against the other, and so strong their love for their paramour, that they battled two centuries for her hand, time and again nearly besting the other in politics, or sport, or even science, and yet neither ever could gain the upper hand.

And all of Mars wept when, tired of the endless battle for her love, heartbroken over the losses and destruction caused for her hand, their paramour turned her eyes to the stars, giving up all claim to her lands and title as she set out to explore the great unknown. No one now remembered her name, that long ago girl, but everyone remembered the endless battle for her hand.

No one knew the exact stipulations of Baron Caramel’s bubble, but his greatest quote ran the length of the room.

“Honor above all. Except love. For that, no greater battle can be fought.”

To see the man in the flesh, after years of being implicitly compared to his evil enemy, was an odd sight for Suni. Baron Caramel certainly looked like the man captured by the sculpture. But his strong, broad shoulders were hunched as he sat, crumpled in upon himself, on the floor of the great chamber, isolated by the decree that hung above the doors, demanding all visitors turn aside.

Muffled sobs emanated from the form as Elizabeth and Suni approached. When he heard their approach he turned away from them and said,

“Leave me! This is my monument, is it not? Let me appreciate it in peace!”

“Sir, we are here to return you to your bubble, should you wish.” Elizabeth said, ignoring the anguish in the man’s voice and striding forward without any care for his desired privacy.

The knight wiped a fine sleeve across his eyes, then finally turned towards them. Suni was shocked at the deep sadness in the fairy’s eyes. So often any true emotion was hidden beneath AR masks, and yet here was a man so lost in sorrow that he did not take the half-moment to hide his face. Red blotches and sticky tears marred the handsome face that was so familiar from the monument.

“What’s the point? With this, my conditions will never be met. What difference does it make if I die now, by my own hand, or by the cold vacuum when Mars finally forgets my name?”

Varanus, with her normal efficiency, simply said, “Your original condition was to be returned when your name was forgotten?”

“No. When this story was forgotten. When the lie of Caramel and Cardinal finally finds the death it so truly deserves. Then I will be free to return.” He shook his head. “But this...five centuries, and it still haunts me?! How will we ever be free of this curse?”

His hand grasped the sword at his side, hard enough to send his dark skin white. Then, apparently through force of will alone, he released it and lifted his eyes to Elizabeth.

“But if my choice is to live with this, or to walk back into the void just for a chance of happiness, what choice do I have? My condition will remain the same.”

Elizabeth nodded and raised her hands, ready to return the man to his bubble.

“Ferdinand! Wait!”

The Baron jerked from his pose, whirling towards the voice. Another fairy, this one still boasting vibrant blue wings, flew towards them, stepping through Caramel’s barriers as easy as Suni and Elizabeth had.

He didn’t stop until he bowled Caramel over, shoving him out of the way of Elizabeth’s still-raised hands and leaving them tangled together on the floor.

“Sebastian?” Caramel’s eyes widened, “You’re…”

“You’re not supposed to be back!” Elizabeth interrupted, eyes narrowing. “The Rogues’ hall is five floors away! The Imp couldn’t possibly - “

But her words were completely ignored when Baron Caramel surged forward and wrapped the other fairy in a tight hug, which the other man returned with equal strength.

“I thought you’d be dead by now.” Caramel whispered into the man’s shoulder. “I thought…”

“That I’d leave you behind? Idiot. I bubbled myself the moment I heard.”

“I wanted you to be free of this. But look, Bas, look what they’ve made of our lives.”

The blue-winged fairy glanced over Caramel’s shoulder, at the walls depicting the endless fights, and snorted.

“Your parent’s always were asses, Nan. As were mine. Of course they’d try to control us from beyond the grave.” He pulled away, hands on Caramel’s shoulders, and looked him in the eye. “But why should we let that stop us? Why wait for an eternity, when we can seize our future right here, right now, and tell them all to go to hell?”

For the first time, something other than sadness grew on Baron Caramel’s face. He moved to speak -

- Only for Elizabeth to shout “Excuse me! This is the middle of a crisis. I need to know if the Imp has gone off course now. Lord Cardinal. Why are you out of your bubble?”

“I think it’s pretty obvious, Dr. Varanus.” Suni said, only to earn a glare. But he stood strong against it and continued. “Sebastian - Lord Cardinal, I mean - asked to be returned when Baron Caramel was.”

The blue-winged fairy, who didn’t really look much like the other bronze man, but was still recognizable by the army uniform and sword, nodded.

“And even if the Baron’s bubble was opened early, Lord Cardinal’s was opened correctly. His awakening is totally unrelated to the Imp.” Suni paused, looking between the two men, “And...I don’t think we’re needed here anymore. If they go back into a bubble - “

“ - we’ll do it together.” Caramel said, smiling for the first time, even as Cardinal said, “We won’t need your help.”

Now it was Suni pulling Elizabeth away, as her brows knitted in confusion and she opened her mouth to ask more questions...that Suni doubted either man was particularly interested in answering. Another fairy, another unnecessary bubbling. He was beginning to see a pattern.

----------------------------------

“Oh!”

Suni jerked at Elizabeth’s sudden outburst. They were continuing through the palace, more or less in a straight line, towards the next reported instance of early awakening. Suni hadn’t thought much of Elizabeth’s silence over the last few minutes; she was the sort of person who didn’t seem to need to fill silence with conversation. But still…

“They were lovers.”

“Oh. You mean Caramel and Cardinal. I thought that was obvious.”

“Perhaps to an outside observer. But I was a girl when Caramel bubbled himself. Everyone heard the story of the two champions, leading their rival clans in their feud. It took two centuries of arguing over whose fault it was that they bubbled themselves before the Caramels would even allow the Cardinals into the nobility, and vice-versa with the Caramels and the army.”

Suni shoved his hands into his pockets. “So just like Romeo and Juliet.”

“What?”

“An old Earth story. Dawn adores it. Two lovers, their families at war, and the only thing that stops it all is the kids dying for love.”

Elizabeth sniffed. “What a stupid thing to do. As if death - or bubbling - could solve anything.”

“Sounds like, in this case, it did. That monument was a joint venture between the two families. And they’re close allies in the high chamber. Maybe Caramel did get his real wish - for there to be no barrier to their love - without needing to be forgotten.”

“Hmpf.”

“Don’t you think that’s interesting? Of the three Awakened fairies, none of them needed to go back to their bubbles. It’s almost as if…”

Elizabeth paused before a crossing, waiting for Suni with his shorter legs to catch up.

“As if what?”

“As if the Imp is targeting certain bubbles. Is that a silly idea?”

Elizabeth considered. “No. As chaotic as this has been, that creature could have caused far more disorder. In Cedar’s wing alone there are a good two-dozen bubbles just as easy to access as Ashbury’s was.”

“But all of those people come back regularly, whenever their farming expertise is needed.”

“Exactly. But this might be more dangerous in the long run.”

“How so?”

“Well, the chaos thus far has been contained. But if the Imp is looking for those kept in endless bubbles...it might bring back those we never want returned.”

---------------------------------------------------

Beneath the palace the ground rumbled, the machines of war waking from long slumbers, some never once having been used.

The centipedes were the first to awaken. They came back quickest, for it was not uncommon for one fairy plan or another to require sudden and unprepared movement of large amounts of materials.

Their handlers coaxed them awake, and they grumblingly answered, making their way to the surfaces out of the vast warehouses beneath the palace and into the light of the army grounds. Stranger creatures came after; moles the size of buildings, wearing blinders to block out the sun; spindly mosquitoes with huge gas-tanks where their abdomens should be, ready to release pacifying fumes; feathered dinosaurs designed for speed yet towering over the turret-guns attached to their chariots - all to be greeted by the army's own menagerie of dragon-copters and reconnaissance bats and some of the tinier spiders who could handle the Martian gravity.

The General grumbled at the delay, haranguing any within earshot about the speed of their reaction, and the other generals gritted their teeth and wondered why he had been given command for this mission.

Yes, of all of them Roland was the one who knew most about the goblins. Yes, he was the one who had fought them, given victory to long ago fairy, and chased the monsters back into the dark.

But...and of course none of the other generals even hinted this in their deferential words, but...

But if Roland wanted speed he would not be calling up the entire army and using the centi-trains to get to the Goblin City. But after a blistering tirade aimed at an aid who had the misfortune of mentioning that "wouldn't the space elevators be a far quicker way to move troops around", none mention that the Crown Princess might have had the right idea. Fairies could fly faster than centipedes could run. Scouting could be done before the army as a whole assembled. Attacks on the goblin's dark-net and defenses could be made, even from across the whole planet, by using the over'net.

But there was a beautiful simplicity in Roland's plan. Call up the army. Load it onto the trains. Find the Goblin City. Attack. Deal with the Goblin threat once and for all. Retrieve the princesses.

The troops liked simplicity. The populace liked to see that something was being done.

So the rest of the army command held its tongue and went about re-interpreting Roland's whims into something sensible. They could always write it off as a training exercise if everything went to hell.

Chapter Text

In her mind’s eye, Marianne was watching fireworks.

More accurately, she was tracking Rose and Lilac’s trip through the Underground, as the two used their unique skills to chart a safe path to the Goblin city.

Lilac kept their connection to the net strong, even as the two flitted around and through the dark-net the goblins had erected. And Rose…

Her motions defied the logic of a flesh-and-blood being. A human, Fairy or ELF alike, would have navigated the Underground as best their body could, coming upon turnings and choosing logical paths and then back-tracking if the path proved wrong. And thus mapping the maze of the Underground would have taken days, if not months, to find just the right path.

An AI didn’t need to do that. Instead, at each major junction, the two small AIs hovered, and then Rose split, dozens of copies expanding from a central hub, each assigned one path to explore. As each copy found a dead end they dissipated, leaving only those unhindered to move on. It was the same technique the AI used to fight, mapping all possible paths then snapping into the one with the most chance of success only after her opponent began to move. Quantum dominance, and she remained undefeated in battle, even as her skills lead the AIs to speed almost as fast as light through the underground, the true challenge being to ensure that a physical being like Marianne could traverse the same path the insubstantial AIs could. After such a feat, the only other task was for Lilac to follow behind, clever eyes seeing what Rose did not, sending all that information back to their waiting master.

Pause. Burst. Follow. The pattern repeated at every split, as the two AIs worked their way deep into the Underground, following pathways that the Goblins themselves likely hadn’t used for centuries. The creatures of the dark had no need for the light, after all. But from the shattered wrecks of the first city of Mars, there had to be a way down to the old caverns that had been grown to house the refugees of Earth, and now were home the most despicable creatures caused by its fall.

Marianne hated waiting for their work to be done, so she followed them through the ‘net while keeping her own invisibility strong. The AIs had no need to be physically manifested, except in the rare place where no over-net at all reached, so most of their work was undertaken by racing through the networks and then popping into existence for a few fractions of a second to jump from one system to the next, then dashing on again.

As they worked, Lilac filled in their map with more and more detail, showing their progress and matching her sight to the patching information the royal archives had been able to provide. It quickly became clear that no non-goblin had explored the area for centuries, or at least none had survived long enough to record their findings.

Which was a pity, in some ways, for the shear history the place held. The world that could be glimpsed through Lilac’s eyes was a physical record of the history of the human habitation of the whole planet, as what began as ancient, decayed ruins of a time almost lost to history became more and more familiar as the two AIs advanced, until suddenly it became utterly alien once again.

It began as broken splendor, a giant wreck filled with tiny rooms stripped of everything that might have once been useful, lush carpet decayed away into bare concrete floors, lights long gone, graffiti scrawled on walls in a thousand dead languages. The halls were small, even the service corridors sized for nothing larger than perhaps two wingspans wide. 5 meters, in ELF terms. The larger rooms, what could have been a ballroom, or a kitchen, or maybe a Colosseum, would barely fit a few thousand. A home to a people far less grand than any Fairy, still uncertain on their control of technology that would soon come to define them.

Then things shifted. The hotel had never been designed for a space dock, but the crisis on Earth changed everything. And that was where the true entrance to the Underground was. A cavernous opening, its doors rusted shut and impossible to see from above, the dock opened into a wider corridor on proper, industrial scale. A whole army could have easily marched through that hall, and likely would, should Roland have his way.

From there it was down into the first permanent settlements, giant rooms carved out by bubble-tech, floors still slightly wavy from the curves the bubbles gave them, speed being preferred over any semblance of care. Giant rooms filled with beds and work stations, canteens and offices nearly indistinguishable through the fact that everything had been simplified to either benches, beds, or tables. The bubble system had been implemented before most of the refugees even made it to Mars, but even the friends and relatives of the few true Martins had raised the population of Mars by ten times, and then on top of that there had been the militaries and governments that thought themselves indispensable when the survival of humanity was at stake.

They hadn’t been, in the end, but all together Mars had gained a population of nearly a quarter billion before the harsher measures had been put in place, and that time had made its mark on the ancient Underground. Beneath the canyons there were a million miles of tunnels and whole cities carved out of the rock, those early years having stripped resources down to a minimum and safety easiest when all oxygen could be cushioned by several miles of impenetrable rock between it and the grasping void.

Decay had come to rest here as well. Many of the giant rooms were collapsed. Most that remained standing did not have breathable air, the fans and filter systems having long ago failed or been scrapped for parts. But once all of Earth had tried to cram itself into the area Lilac and Rose sped through. Now - no, even then - no one had wanted to remember that time of terror and need, so the ugly, practical caverns had been abandoned as the new Fairies had returned to the surface and taken back control of their world.

Only the Goblins would take up residence in such a painful memory. But their homes were even further down, the same logic that had the early humans burrowing away from the surface instructing their choices. On the surface detection was easy. Oxygen may now be plentiful, but the rest of the necessities of life were not. Water. Food. Tech.

As Lilac and Rose found, the Goblins had found their way to the cusp where human history had shifted to Fairy, where the first inklings of modern technology had grown and expanded. Deep, to where tunnels were grown not drilled, where fungal networks became the first over-nets, and the needs for ever more food for a starving race of humans had turned into radical bio-engineering that would have been outlawed as mad by any sane Earthling but was laughably small-minded to the modern eye.

Of course, those early, desperate scientists had created horrors, even as they built the foundation for what would become the modern world. If Suni’s trip through the Underground had been dangerous, this was on a whole new level. Lilac flinched away from caverns with creatures that breathed poison, tunnels where fields could atomize anyone foolish to walk through them, places where where stone flowed and clouds shattered, impossible AR tricks becoming real as the AIs took one glance and fled.

They snuck past sleeping goblins and prowling Cheshires, avoided dangers both real and AR and, faster than humanly possible, but still frustratingly slow, they charted a course to the Goblin City.

It took four hours of work, four hours of Marianne desperately wishing to follow, four hours of who knew what horrors enacted upon her poor sister, before Lilac and Rose were done. It would take another two before Marianne could reach them, creeping slowly through pathways that even the Goblins had likely forgot, avoiding monsters and traps in equal number, squeezing through over-grown tunnels and speeding over bottomless pits, before she reached them.

But she did it. She reached the Goblin city, held in the largest cavern in all of Mars.

----------------------------------

No goblin noticed her passing. Those that might otherwise be watching the wyrd-ways had their eyes turned outward, tracking the snippits of information dribbled out by the cautious goblins observing the Fairy army as it began to move. Most goblins would have never even considered looking for a scout, leaving protection to traps and the monsters that patrolled the upper halls.

So only two creatures noticed her passing.

The Sugar Plum, deep in her cocoon, sensed her sister AIs, and the master that trailed after, as they passed, but said nothing. Most of her fractured mind was focused upon strengthening the Goblin City's defenses, following both an order from the Goblin King and her own needs. The two slivers of her that did notice immediately fell into dispute, one furious at the approach of the daughter of the woman who imprisoned her, the other eager to see the chaos she would bring. Their argument was ignored, shelved in the back of the AIs mind, and nothing came of it.

The other, The Green Knight Roland, winced behind his AR shield. His Princess had moved faster than he had anticipated. Without his cautious concern, presenting the idea of exhaustion into the girl's mind with seemingly genuine worry, she had broken speed records that hadn't been challenged since Roland himself had sabotaged the competition centuries ago. Of course he could have beat her, had he tried, but still. He would have to trust that the rest of his lessons had a more lasting effect on her.

She was just a silly girl, after all.

So he turned back to the army, finally, finally ready to depart, and welcomed one of his pets to the stage. Even without AR, she did rather look like the Crown Princess, and anyone able to notice the discrepancy would write it off as mere pageantry, inspiring the troops with words that Marianne herself would be horrified at.

Sandra read the words Roland had written for her perfectly, true conviction in her voice as she spoke of the vile monsters that lurked beneath the surface, endangering everything that Fairy hoped to build. She wove a story of brazen arrogance, unrelenting cruelty, and the theft of everything Mars held dear. Creatures of corruption, fit only for oblivion, privileged to be allowed to live in darkness, who had finally earned their just demise. The whole army was enraptured by her voice, lowly ELF batman to Generals who should have known better, hanging upon her fantasy of a world besieged, allowing her to lead them into belief.

There were cheers as she finished, and her eyes were full of adoration when she turned back to Roland. One smile from him was all she needed, and then she was happy to return to her bubble, to wait for the next time he called.

Would that the real Marianne be so docile. But she would see the truth in Sandra's story soon enough, Roland was certain. After all, his words rang true because he had been there. He had seen it. All those horrors, the abandoned and despised trash of a Mars grown beyond, lurking right where she would have no choice but to see.

Roland could only hope that the horror of what she saw caused her to run straight back into his arms. If not, it would at least return her to a more appropriate opinion of the goblin scourge.

----------------------------------

By the time Marianne reached the Goblin City, she was shaken. She’d stumbled across things she thought had been invented just to scare children. Tiny spiders, only the size of a room, building webs across whole caverns and leaving grisly remains of victims against the perfect spirals. Vines made of more spikes than substance, cutting off whole tunnels, thorns seeming designed with the intent to shred any wing that came to close. Carnivorous plants large enough to eat whole ELFs in one snap. Things that shouldn’t exist any longer, if there ever had been a reason for them to exist in the first place.

It was as if all the mistakes of Fairy and Humanity were knotted together in one place; a place where everything that both had wished to forget had come to rest. Hung on the cusp of history, in the last great cavern of the times of crisis, connected to the rest of Mars through the living subterranean systems that once had connected every Fairy outpost, the Goblin City sat.

The roof itself was held up by giant trunks the size of skyscrapers, and treated the same by the goblins who lived within them. Tiny beads inched up the trunk, vehicles made tiny by distance and the sheer number of them. Light came from bio-luminescent mushrooms and algae and caged glowing creatures, making the world glow with an eerie green that sometimes pulsed like waves as its creators breathed. Beasts long ago outlawed for aggressive behaviors or mis-harmony with their environments wandered the surrounding corridors unhindered, feasting on equally violent plants eager to snap at unsuspecting feet. Other plants spit poisonous mists or raked vines along aperture floors, as if intentionally trying to trip or entangle. Everywhere insects crawled, drawn to the lights or smells and liable to be crushed under foot between teeth.

Even cloaked in invisibility Marianne flinched away from the cruelty she passed through. There was death here. And pain. Things made so unnecessary to her Mars, and yet even the plants themselves engaged in the violence of this twisted world the Goblins had made.

If the goblin king had been a dark opposite to everything a Fairy might aspire to be, then his city was the same as he, a cruel mockery of everything Fairy had tried to build, taking in every failure and banned creature and lumping it into one hideous mass.

Every story Roland had ever told her as a child came rushing back as Marianne looked out on the crawling city, and she faltered long enough to be ashamed of her cowardice.

And in that moment, she forgot something rather important about her aids, and set rolling a crisis that would quickly grow out of hand.

------------------------------------------

Chapter Text

It might bring back those we never want returned.

Despite Lady Varanus’s dire warning, the next stop on their route - and the last of the obvious anomalous bubble openings - was about as far from “never want returned” while also ensuring maximum chaos.

A storeroom attached to one of the oldest Fairy families had been upended, disgorging two dozen different people along with pets, plants, and who knew what else. This time there were both Fairies and ELFs, and Lady Varanus had been alerted to the situation by panicky queries to the over'net system by both the Chapman family and their newly returned staff.

The former had quieted completely by the time Suni and Lady Varanus arrived. Worse there was a virus working its it's way Through the over-net deleting any hint of the prior queries and silencing anything more from the servants.

For that is what they were: servants, all having been shut away upon the bubbling of Eric Howel Chapman the 3rd, the head of the family twelve centuries previously, so he could have all his favorite things - including people - when he returned.

The thought alone turned Suni’s stomach. Such things were highly illegal, going against every established custom. ELFs worked hard to prove their worth and work to remove their families from bubbles. To casually toss aside that hard won freedom was monstrous, and almost unthinkable on the scale that Chapman had performed. Certainly it was not unheard of, and there was a reason every ELF child was warned of angering a fairy, but the scale of the crime would be a black mark on the Chapman family for decades to come, should the word get out.

Perhaps it was no surprise, then, that upon their entrance into the Chapman suits they were met with a half-dozen armed fairy guards and a very pompous majordomo denying their entry.

Wails and shouts could be heard from further down the corridor, along with crashes and skittering, the source hidden by a hastily thrown up AR wall that Suni could see right through, though any without the majordomo's clearance would see nothing amiss.

Lady Varanus stopped, expression darkening as the fluttering flunky stepped forward. The guards had not drawn their swords, yet, for to do such a thing would be equivalent to challenging the government itself, but their hands rested loosely on the pommels, just as effective a message; they were ready at an instant to defend their masters’ reputations, only waiting for a silent word from the major-domo.

Sir Byrant ruffled his wings before beginning his tirade. “Dr. Varanus, why have you disturbed my masters at such a terrible time? The young princess is gone, captured, and you find time to disrupt the functioning of the house with your slanderous, unjustified inquiries? Have you no shame, after all that my lords have done for you?”

Lady Varanus’s brows arched. “You seem keen to tout your family’s helpfulness until actual action is required.”

The tittering flunky puffed up his chest in indignation. “Nothing can be done while we are in morning for our dear princess." He sniffed and waved a hand. "Should we need your services, we will call for you.”

Suni watched as Lady Varanus’s eyes narrowed. “As an agent of the Martian government, I insist that you step aside.”

Sir Byrant quaked for a moment at her glare, his AR mask flickering as he caught sight of his opponents eyes beginning to slit. But his pattering mouth continued on, years of practice coming to his aid. Suni was almost impressed, if the babble of terrified voices from beyond the wall hadn’t served as a constant reminder of just what Byrant was so keen on protecting.

“Agent or no your appearance insults the honor of the Chapman name. Fifteen centuries of dedication, sacrifice, suffering for the crown, and this is how they are repaid? I simply must ask you return with the proper authorizations. It is only right that in a time of such chaos that - “

Byrant continued on, but Suni was distracted by motion at his eye level. Lady Varanus was staring, scowl blistering off her face, but one hand behind her back flapped expressively. It only took a moment of consideration for Suni to interpret the gesture.

Byrant and the guards were fairies. They had barely even noticed him. All he had to do was…

He took two steps sideways, slipped behind a servant’s shield, and instantly disappeared from the view of the Chapman toadies. To go so far was probably unnecessary: the fairies would likely not have noticed him even if he carefully slipped around them in plain view. After all, these were the kind of people who would hide a secret for fifteen generations rather than undo an unbelievable cruelty to a few servants.

He slipped from behind the screen just long enough to nod to Lady Varanus, then hurried on towards the screaming only he seemed to hear.

-------------------------

When Suni arrived, the situation was worse than he imagined. The storage room had been barely bigger than a closet, and the corridore not much larger. When the bubbles had burst people had fallen from high shelves, been slammed into corners and broken down the door via sheer volume.

In a bare six seconds Suni saw more real injuries than he had during his entire time serving the royal family. There was blood on the tiles, at least two broken bones, and bruises developing on half a dozen miserable faces.

It was only made worse by the shouting. Everyone seemed to be yelling, or crying, or both at once.

But the second thing Suni noticed - beyond the blood - was that the fairies looked just as lost as the ELFs. And it was difficult to tell who was a fairy. Some had wispy wings, true, but they looked far less substantial than any Suni had ever seen before. Added to the fact that there didn’t seem to be much difference in height or clothing, and it was actually difficult to parse who was who.

Not that it mattered in that moment. But it was still something Suni slotted in the back of his mind for later.

“LADIES, GENTLEMEN, AND OTHERS. PLEASE BE SILENT.” It wasn’t much of a trick to make his voice boom down the corridor, but it worked well enough.

The crowd quieted enough for him to quickly draw their attention. With a thought he drew a platform from the wall and jumped to the top, forcing himself to ignore the flicker of memory of the last time he was the center of attention a scant few hours ago.

“My name is Suni Dai. I am an agent of the Bubble Repository.” Not quite the truth, but it quieted the crowd more. “Please be calm. Emergency personnel are on their way to see to your wounded.” A thought and this was also true. “Please help me move the injured to the edge of the crowd.”

Quite a few - Fairies and ELFs alike - opened their mouths to shout questions, but the packed corridore worked to their disadvantage as several others got to work pushing and shoving to make paths for the injured.

Two minutes later, the crowd had dispersed down the corridor a bit more, and the girl with the broken arm, the three people with head wounds, and the five others with more minor injuries were waiting for the medics closest to the door.

One of the Fairies apparently had some first-aid experience, as he had immediately torn his shirt and was pressing the heavy velvet to the temple of the boy with the worst wound. His wings buzzed with worry, and the sight was surreal. A fairy, setting everything aside to help an ELF. Who were these people?

“All of your questions will be answered in time. We have awakening technicians on the way as well. Please remain calm until then.” He repeated, hoping that Lady Varanus would be able to get her technicians through. He didn’t know if he could prevent panic unless they hurried.

“Until then - uh - could I get everyone’s names?”

----------------------------------

By the time Lady Varanus browbeat Sir Byrant into letting her past she had been joined by five awakening techs and an ELF with a medic bay. The later simply ignored the guards and barreled her way through, not caring about the affronted noises that followed her. The awakening techs at least bowed to Varanus before hurring on in the wake of the medic, and they did her proud in the way they barely hesitated before following the ELF through the seemingly impenetrable wall.

Lady Varanus followed at a sedate pace after, Byrant nipping at her side but brought to heel with so many threats that he finally scuttled off to warn his masters of the impending fall-out. He did not drop the AR wall, though, and her pinched face drew up even further as she was forced to wave a hand to clear the image of stonework from her eyes. What she saw when it cleared surprised her.

Suni stood on a stone podium, hands out as if commanding a strange symphony, his uniform slicked with sweat but his smile bright and open.

“So, I see that Miss. Maureen and Mr. Noori are second cousins once removed, through a Mr. Edwin Curry. According to this you were both at his 78th birthday party. “The one with the balloons” is what the note says…”

There was a gasp, “Oh! How could you have got that?!” A young ELF said, and craned her head over the crowd to find an older man in blue livery who waved a hand.

“They were puce.” The man said, and the woman burst into laughter.

“Oh, I remember. But how does he know?”

“Do me next!” A middle-aged woman called out, and there were half a dozen other cries of “yes, yes” in response. “I went to school with someone in this room…”

“Of course. Miz. Maple.” Suni said, then caught sight of Lady Varanus. He stuttered, “Ah, but it looks like the professionals are here.”

“Yes, thank you, Suni.” One of the Awakening Technicians - Diane - said, pressing a warm hand to Suni’s shoulder.

She turned her smile to the waiting audience, her eyes equally as welcoming to Fairies and ELFs alike. Despite their discomfort, several returned her smile with hesitant ones of their own.

Then her expression turned stern. “I am very sorry this has happened to you. But we are going to do everything we can to rectify it. If you will follow myself and Duane, we will take you to the Awakening chambers and get everything sorted.” She held up a quick hand before any could interrupt. “I know you have many questions, and I promise we will answer them all as soon as we make sure you are all safe and healthy.”

“Are you going to bubble us again?” There was a shout from the back, and Lady Varanus pursed her lips. The words had come from another technician, though it would be impossible for any but a fellow tech to realize it.

Ugly questions were not unfamiliar to Awakening Technicians, after all. The career called out to those who could recognize such questions as necessary and answer them as best they could without shying away.

Diane shook her head. “No. Maybe some of you will choose to return to the bubbles after your Awakening, but that will be your choice, not ours.” She looked levely out at them. “Something unfathomably cruel has been done to you. We will not ask you to put such faith in us until we can prove ourselves worthy of our trust.”

Surprised, the awakened servants looked to each other, quiet murmurs rippling through the crowd before they as a group decided to follow after the techs.

Diane only paused a moment before joining them, bowing down to whisper a quiet “Thank you” to Suni before she left.

Suni and Lady Varanus watched them go.

“Impressive, ELF.”

Suni glanced up at Lady Varanus, finding it once again impossible to read her face.

“What was?”

“You reminded them that they were all connected. Had you not stepped in, they would have been at each other’s throats soon enough, everyone blaming the others. Now, even if their families are all dead, they will still remember they have friends.”

Suni scratched the back of his neck. “...It was just a trick. They just weren’t used to people who can read the ‘net that fast.”

“Hmm. You have odd depths, ELF. I wonder what other surprises you might bring.”

“About that…”

------------------------------

Chapter Text

In truth, Marianne had not forgotten Lilac’s constant ‘net connection. In fact, she had relied upon it rather heavily in reaching the goblin city.

It was hardly her fault that she had not considered what something as seemingly insignificant as a ‘net connection could do. After all, it was Dawn that was the socialite and Suni who was the perfect manager. Marianne was quickly trying to wean herself from AR as much as possible, given how disastrous misuse could be.

Getting to the Goblin city had been such a problem that she never considered getting out. Or, in this case, what had not been getting out.

Lilac was perfectly designed to bring the ‘net to even the deepest corners of the globe. Her signal was pure, a light in the darkness, stronger than any code designed to block and hide.

And so the Dark-Net of the Goblins, built up over centuries and overseen by dozens of trained technicians, crumbled in one moment, finally letting out all that had been kept back.

It wasn’t much. But it was enough.

The Martian army knew the Goblin City’s location.

And Dawn was no longer silenced.

------------------------------------------

It took exactly thirty minutes before King Dadga called to Marianne, on Lilac’s priority channel, to inform her of the horrifying news.

“The Goblin King has demanded your sister as a bride.”

Marianne, who had been sneaking stealthily towards the bulbous mass of the central pillar, home to what was surely the goblin castle, froze in horror.

“What?”

“I don’t...I cannot keep this from getting out, Marianne. I don’t know what they’ve done to her, but - “ His voice broke, and he sent over the announcement that Dawn had made, just minutes before, flooding the ‘net with a highly excited plan for a wedding.

Marianne looked on it in horror.

It was pink. There were sparkles. And a guest list. With invitations already sent out.

The date had been set on the spring equinox, on the anniversary of Marianne’s own failed wedding, but she had been seeing red even before she noticed it.

Princess Marianne of Mars, First in Courage, Leader of Wisdom and War, Duchess of the Final Justice, Mistress of Science and Leader of the Army, Crown Princess to the Throne of Mars and eternal ally to all of Reason in the Galaxy, was pissed.

All thoughts of kindness, of giving the goblins the benefit of the doubt, of trying to understand their twisted logic, it all fell away before the thought of her baby sister sacrificed to that. The monster. The villain. The horror in all the stories.

King Dadga called out, but it was too late. The connection was severed, Lilac left behind in the dust, as Marianne once again broke the rules of speed as she snapped towards the castle, red her eyes and mind on fire.

It was almost, almost possible to miss the tiny, incidental flicker of misplaced irritation at her perfect, infallible, captured sister.

But it was there, somewhere, in the maelstrom of anger slapped on the monster in her mind. Tiny, overwhelmed, but there. It whispered:

She stole my fucking idea!

----------------------------------

The word went out, faster than a shot could echo, across all of Fairy in an instant. Highest to Low, least important ELF to the very King of Fairy himself, no one was beyond Dawn's reach.

At least, no one with a net connection. The one person who perhaps could have stopped the disaster in its tracks was asleep, exhausted from a whole day of trailing behind a mad imp and a worse Fairy. Four hours ago, a fight had broken his 'net glasses, and as he slept he cradled them close, nightmares nowhere near as horrific as the reality he would wake to.

Of all of Mars, only one person benefited from her words.

General Roland, forcing his army to move through the night, received the news almost as fast as the King himself. He instantly hardened his AR into an impenetrable wall, all to hide his absolute glee, even as the generals around him reacted in equal parts horror and despair.

He really couldn't have asked for anything more perfect. And he would be sure to take every possible advantage.

Chapter Text

This is what happened when the Crown Princess of Fairy and the King of Goblins met for the first time in their official capacity:

Marianne smashed through the giant spider-web window over the council chambers in the Golin Castle.

The Bog King, who had been nodding off as he listened to reports from his various committee leaders, had pulled his staff from bubble-space and deflected the first blow completely on instinct.

“Release my Sister!” The fairy warrior screamed.

Bog glanced at his councilors, and shouted “Get out of here!” before throwing himself at the girl. Luckily most of them obeyed, leaving only the most thick-witted or curious behind. (Thang counted as both).

She clearly didn’t expect him to recover so fast, so he actually managed to throw her off balance with his rush. He forced her back and upward, away from the fleeing councilors, her sword cutting into his staff as she wrestled against him in strength.

He had bulk on her, but that only worked until her fields kicked in. A moment later they both dropped as a stone, the pressure placed on his staff tripling in an instant as gravity suddenly affected her more.

But it was easy for him to switch his grip and let her sword slip down his staff, striking sparks as he dodged out of the way and back up. It took her barely a moment to slow her fall, wings flickering as they shifted fields, and she glared up at him from beneath their purple fringe as she readied her next attack.

The anger in her eyes was so pronounced, it was almost impossible that he recognized her.

“Wait - “ But she was on him again, her sword cutting in a long arc, forcing him to deflect it rather than dodge completely. But he spoke as she shoved him again. “You - you’re the girl from the ball!”

She slowed for a second, and he took the opportunity to dash away, his speed equaling hers.

She took the moment to draw herself up, vibrant purple wings flaring behind her.

“I am Princess Marianne of Fairie, and you, monster, have stolen my sister.”

The thought of the firebrand before him connected in anyway to the girl in the hospital momentarily shook him, and he barely had time to block her next attack, even as he swore. “Not another princess!”

“Oh yes.” she hissed, glaring over the sword, straight into his eyes, “You didn’t think you could escape, did you?”

But he had tricks of his own, and he threw her off with a counter burst of field-given momentum. What a fool he’d been, thinking she had been sweet. Kind. When she was just another screaming harpy…

“Should I be scared, tough girl? Scared of a pampered princess?” he taunted, not giving her a chance to recover from his attack before leaping towards her again, wings giving him added speed, the wicked head to his scepter aimed at a chink in her armor.

But she swung her sword in a block with more strength than he imagined. It was hard to field anything but straight blows, but the curve of her attack had rung with more power than her frail body could have ever produced, enough to send him flying towards the wall.

“I’m not one of your ELF princesses.” She said, spinning in the air with her momentum then turning it to a weapon as she drove down with her sword straight out, speed flickering round the tip.

But straight attacks were easy, and Bog merely rolled a shoulder and let her fly harmlessly past him, choosing at the last moment to kick at her back. A dirty move, even for a goblin.

It didn’t hit. Instead she sensed the kick and plummeting out of the way before slowing her momentum a mere instant before reaching the floor. She turned as she touched down, glare darker, and he smirked down at her.

“And I’m not your fairy tutor. Care to learn how to really fight?”

And then he pulled his own trick.

He shifted out of reality.

He grinned as her eyes widened and darted around, looking for a shimmer to hint at invisibility. She wouldn’t find one. He let everything from the world around pass through him, keeping only enough of himself moored to this dimension to see her expression of shock.

Then it was only another trick to let just enough of himself be touched by gravity to ease close to her, descending achingly slowly as her panic grew, the strain on his mind worth it for the sight of her uncertainty.

He allowed himself a moment to hang, immediately behind her, before he eased back into reality silently and whispered to a quivering ear.

“Gotcha.”

He would have caught her, were it not for the impossible thing she did then.

His hands reached out to where she would have been, had she darted forward in fear, still pulling himself back to reality.

Instead, he caught nothing, because the girl had spun instead, one hand darting out and catching a bit of him that was still coalescing - in this case, a ridge from his chest-plate.

“How - “ She started, then she concentrated. “Ah. There.”

And she was gone too.

Bog barely had scraped his jaw from the floor before he was fending off another attack, the girl slower to pull herself from one dimension to the next, still fuzzy at the edges as she charged from behind him.

He dodged away, instinct coming to his aid again as he clutched his staff to his chest, wings buzzing.

“How - Don’t you know how dangerous that is?”

“Is it?” She asked, drawing her sword back in a waiting stance and cocking her head to one side. “Is it supposed to be hard?”

She flickered out again, but he was ready this time. He caught her in the nearest other dimension, just as she was about to attack his back.

There was no sound here, so the clang of their weapons resonated only as a numbing hum against his hands. But he would not allow her to shock him for long. So she could learn one trick. Try another, then.

He pushed forward, only his own strength available for the moment, and she was forced back in the silent other-world, and then shifted again, moving right through her as he passed back into reality.

This time he dropped, not trusting her to be surprised for too long, and slipped back into the other dimension to attack from below.

He was grinning when she met his strike, and they flickered back to reality together, her trying his new trick at the same moment he did.

Maybe it was only fair that she showed off one of her tricks next, and as he tried another blow light erupted from her in a wave, bright enough to burn and blind.

For that he snapped into normal invisibility, letting the worst of the light pass through him, already readying his defense for the instant later when she attacked anyways, proving his guess that she had sharp enough eyes to follow the distortion.

He ignored his stinging eyes and immediately snapped into the other-dimension to avoid the burst of sound that was surely coming, then went on the offensive once again, calling his own colors to his aid and bathing the whole room in a sickening, pulsing green that went straight to the last remaining human bit of the Fairy brain and pressed a button marked “queasy”.

She slowed and he knew it had worked when she closed her eyes tight and drew a shade over them for good measure. He took the moment to throw his staff at her. She dodged easily, but barely avoided it as he called it back instantly with gravity.

“Ready to give up yet?” He called, and surprised himself when his words came out less arrogant and more interspersed between heavy breathing.

“Ready to give my sister back?” She called back, also winded.

He put aside his tricks - of course not because his mind was starting to feel the strain, but because it would surprise her - and physically attacked her again.

For a moment they simply exchanged blows, back and forth, her motions so fast he almost wondered if she was reading his mind. But then he wouldn’t have been able to avoid her attacks just as easily.

Speed. Agility. Field Control. The princess matched him rather nicely.

“Is this the best Fairy can do?” He taunted, falling back on older, human, tricks. “Or are all princesses so weak?”

There was a twitch on her face, and he knew he hit home. No princess with that kind of fire in her eyes would stand being spoken down to.

“Aren’t you supposed to be sitting on your ass in a tower waiting for some knight to come rescue you?”

Another twitch, and her next rush was far easier to dodge, her speed the only thing getting in the way of him making a counter-attack. But he remembered something more - hadn’t he heard something about a failed wedding...

“Shouldn’t you be sitting back and letting your husband do all the work?” He saw her turn red, and wondered if just a bit more would cause her to explode.

What he didn’t realize was that the only thing that kept him alive in that instant was his next words.

“Or did the wedding-bells just not ring for you?”

She started, as if suddenly remembering something. The shift was so fast, he nearly didn’t believe his eyes, as anger resolved back into sarcasm.

“Shouldn’t you be the one waiting on wedding-bells?”

He stumbled, memories welling up in that moment, and she attacked. The sword scythed through the air, and it was only miscalculation on her part that she missed, steel digging deep into the stone behind him and shocking him into motion.

He flitted away, balancing easily on a hanging lamp.

“Goblins don’t marry, tough girl. Everyone knows that.”

“Then why are you marrying my sister?”

For the second time, Bog was shocked into inaction.

“What?!”

He dodged again, but slow enough that she brushed past him nearly close enough to touch, then wheeled to land on another lamp.

“Marry my sister. The entire world knows it now!”

“I -- you - “ He stuttered, and for once didn’t immediately cover it up with arrogance. “I would never marry your sister!”

“Liar!” She shouted and drew her sword up again.

“No. Seriously. In what universe would that ever be a good idea?!”

She opened her mouth to answer, then paused, as if she actually had to consider her dramatic words.

“You...you have thought of the worst humiliation possible to my people! Not only have we failed to save our most beloved Princess, she has also been driven mad and ravished by our hated enemies!”

With the word mad, something clicked in Bog’s mind.

“Oh god.”

He collapsed onto the floor, sitting in horrified realization, staring up at his executioner.

“Her crazy-talk got out. Who - who let her have internet access?!”

The princess started, as her enemy took his eyes off her and glared straight at Thang.

“Uh…” The little goblin started. “I guess the ‘net people have sent you a bunch of messages…”

“THANG!”

The princess’s mouth dropped open, not as if the Bog King noticed as he gathered himself up and strode to the tiny goblin and loomed over him.

The little creature hunched his shoulders and tried to disappear back into the ground.

“S-sorry. It just looked like you were having such fun and I thought…”

“How long.”

“Uh...about an hour?”

“And her - her madness has gotten out?”

“We were so focused on hiding our position, I don’t think anyone considered that the Fairy girl might be sending stuff out...”

Bog dragged a hand over his face. “Of course not. The only person watching her probably helped. God damn it.”

“Er, boss?”

“What?”

“The fairy’s still up there.”

Bog glanced up. The fairy was indeed, still up there. But her sword had fallen and she was watching them with raised eyebrows rather than a death-glare.

“You can kill me if you want to.” He shouted up to her. “But that won’t get your sister back.”

Cautiously, she drifted back down to the floor.

“...I think you have some explaining to do.”

He repressed a groan. “Fine. Follow me.”

--------------------------------------

Chapter Text

“So...there have only been two more reports of Fairies being de-bubble, right?”

Five hours earlier and a planet away, Suni and Lady Varanus were striding towards the next such case, having finally disengaged themselves from the chaos swirling around the Chapman chambers. Suni had to jog to keep up with the long strides of the scientist, but he was easily familiar with that particular humiliation and wasn’t even out of breath as he hurried along beside her, explaining.

“But they don’t seem to be in any order.” He added.

“Four cases are not enough to guess at its motives.” Varanus said, clearly not impressed.

“The potion has been gone for five hours. With as fast as that thing moved, it could have de-bubbled far more people.”

“It might take some time to choose its victims.”

“Yes, but the potion works fast. At least…” He stumbled. “It did on Dawn.”

Varanus rolled yellow eyes at the ugly emotion on his face. “Hardly conclusive. What is you point ELF?”

“If it really is targeting people who have been incorrectly bubbled...why haven’t we been looking for Awakened ELFs?”

Lady Varanus stopped. “There have been no reports of de-bubbled ELFs, except those in the Chapman case.”

“...Right. But...they might not trust the Repository enough to reach out.”

Varanus sniffed. “And why would that be? Everyone knows their technicians are the only option when assisting those through the Awakening process.”

“Yes, but…” Suni paused, balancing the fear of Lady Varanus’s anger with his certainty of the truth. “...but if they were bubbled by masters like Chapman, they might be terrified of being re-bubbled.” He felt her eyes narrow in doubt, but he sped onwards in his explanation. “That’s exactly what the Chapmans were going to do, had we not arrived when we did. The code was spinning in the AR around them. An ELF with that kind of master would be right to worry about being re-bubbling them, just to cover up that they were incorrectly bubbled in the first place.”

“The Repository would never sell them out to their masters. Our technicians are trained - “

Suni interrupted, shocked at his own audacity. “But they don’t know that. Any ELF that’s been brought back is probably confused and scared, and maybe even injured - “ It wasn’t uncommon to bubble those in critical condition, and there were horror stories among the lower floors of Fairy children accidentally maiming a pet or servant and hiding the evidence in a bubble and then forgetting about it, whether intentionally or through childhood obliviousness. “ - They wouldn’t be thinking straight.”

“Hmpf. If they are not interested in our assistance, why should we waste our time with them?”

Suni whirled to face her, halfway to raising his voice. “People could die, and you don’t care?”

“ELFs die all the time. We serve Fairy first.” Varanus said, staring straight forward, not meeting his eyes. But there was less certainty in her stance, just enough of a drop of her shoulders that Suni sensed that he might have hit a cord.

His mouth opened, and luckily his brain worked faster than his feelings, because rather than shouting he said. “...if we know of more de-bubblings, we can track the Imp better. I’ve already found half a dozen hidden ELFs just in the five blocks around us. From that we can get a path.”

Now Varanus jerked to look down at him.

“...you just said they would be impossible to find.”

He steeled himself and held her gaze. “No. I said they wouldn’t report to the Repository. But just about everyone has a ‘net connection. And the first thing I’d do if I was de-bubbled was try to figure out what the hell is going on. And that I can track.”

“......show me.”

------------------------

If instantly reading the histories of twenty five people well enough to guess even the most esoteric relationships was a “trick”, then what Suni did to find the de-bubbled ELFs was true magic.

Not that the little ELF would ever think of it that way. It was just more of what he did every day for Dawn. Reading the social world and finding a path through it all wasn't hard, not like the elegant confections Dawn pulled out of her mind or the masterful fielding Marianne could call upon with a thought. He just looked, at what was laid out for all to see, exactly as anyone else could, and exactly what was expected of an excellent confidant.

But instead of flighty fairies with poisoned words, he was navigating through the massive network of rumors that held the castle up just as much as its foundation.

Lady Varanus had given him half an hour, and now Suni was sitting cross-legged in an unused room staring into the ‘net, trying to ignore how Lady Varanus paced, back and forth, as he worked as fast as he could.

But she’d lent him her Repository authority, so even now there were dozens of bubble-techs following his orders, and ensuring that all of the de-bubbled ELFs were safe and unharmed.

And there were many de-bubbled ELFs. Just in the ten paces to the room, Suni had found two dozen, from all over the under-croft. All he had to do was run a search on queries to the servant’s news ‘net, then filter for IDs that had not been used for more than a week. Instantly he’d found a list of ELFs who hadn’t been seen for years, decades, even centuries, all reaching out. Those were the easy ones to find, and when Varanus’s techs began to report that yes, there were newly Awakened ELFs at all the locations Suni reported Varanus had agreed to pause in their physical pursuit of the Imp to follow it instead through its victims.

Proof of concept now complete, Suni got to work on those he was most worried about - the ELFs who might be injured. Surprisingly, he didn’t have to look far for them, as almost all were already receiving medical attention. A quick query confirmed - the injured ELFs had been de-bubbled close to someone else.

“The Imp must be able to tell who is injured.” Lady Varanus said, glancing into the displays Suni had thrown up all over the room.

“Right. I think it’s moved the bubbles from where ever they were stored and, if the person is badly injured, releasing them right in front of someone who can help.”

Suni found ten such cases, some of whom had been immediately re-bubbled by the people who had found them, but only to quickly transport the injured ELF to the nearest medical area. A quick query to the emergency lines showed fifteen more ELFs who were being treated, some of whom who had called themselves the instant they’d been de-bubbled.

So. Twenty four easy-to-find ELFs. Twenty five hidden injuries. Suni filled them all into his map, indicating where the emergency calls had originated from. A path began to form on the map, still spotty and incomplete, but with a definite line.

Now Suni truly dug in. He pulled up chatter-logs. He skimmed through ancient files, looking for the only other people who would know to access them. He ran searches for people walking oblivious into restricted AR areas.

And, maybe the most radical, he looked. The over’net had eyes everywhere, and with his and Varanus’s clearances there was little he couldn’t access. But few would be able to see the way he did.

Lady Varanus was even impressed. The AR world Suni pulled up was nothing like the normal ELF setup, with different ‘screens’ showing different data from different sources. No, there were too many feeds for that. Suni’s world was layered, one net feed seamlessly thrown over another, building three - or more - dimensional constructs out of things that were never meant to be viewed as such.

Dozens of camera-views of corridors were layered over each other, near-identical except for the fuzzing around the edges, only showing when someone unexpected passed through. Suni had filtered out anyone who was ‘familiar’ to the corridors, and now they spoke to him of long-missing friends suddenly seen again.

Strings of pearls gathered in the corner of his vision, only noticed when one lit up, indicating a service call from an unexpected source. Snuffler sweepers who had been out of commission for years suddenly queried sent a flash, and Suni found another missing/returned ELF hiding in a pantry. Someone made a request to a drink machine for a beverage that had fallen out of favor sixteen years ago, and Suni’s clever vision sent another Bubble-tech to welcome another missing ELF home. A hidden query opened up a half-forgotten corner of the kitchens, and Suni followed it back to its source, trailing through half a dozen systems just to find and ELF who had been bubbled for burning soup.

Piece by piece, Suni pulled scared, hiding ELFs to life, and found some Fairies along the way as well. What neither he had realized nor Varanus remembered was that Fairy was hardly a monumental force either, and some had bubbled themselves in fear of a master who was now long gone, or been bubbled by someone so much more powerful that the gease stuck even when one fought against it from inside.

Others came from the bubbles changed, and hid away in the dark, only to be found when Suni registered an unfamiliar dip in oxygen levels, or a heartbeat where none should be. The Awakening technicians appreciated his warnings, then, as they prepared not only to comfort those who had been stolen from their families, but who also had new fingers, or a third eye, or soft fuzz...or even wings.

After all, unlikely as it was, all ELFs were equally as likely to emerge from a bubble with mental changes as well as physical. And those who conceptualized powers being visible as the multi-faceted, fractal wings of a Fairy suddenly found themselves with wings of their own, impossible as it seemed. There were only a few of those, out of the seventy or so ELFs that had been found, but briefly Suni wondered if others might find themselves with strange abilities, normally only reserved for Fairies, if they pushed their minds just a little further.

He brushed it aside quickly, though, as an error appeared in his matrix.

“...that can’t be right.”

“...what?” Lady Varanus’s voice at his shoulder made him jump.

“My readings say a Miz Andrea Hart was Awakened in sector 5E.”

Varanus blinked, then saw the castle map Suni had drawn up and splattered with color to indicate various Awakenings. 5E was in a lower area of the castle, close to the laundries and closer still to the waterworks.

She spun her own AR to look at the spot Suni indicated. Certainly, there was no one in the linen closet, and the highest shelves showed a layer of dust indicated another forgotten room in a castle full of hundreds of such.

But the lower shelves…

It was clear where the Awakened ELF had come from. There was a shattered jar on the floor, glass splinters coating the floor, flecks of blood upon some where the poor ELF might have stepped down upon their former cage.

But that did not explain why the other shelves were upended. Nor why, upon closer inspection, much of the blood was not human red, but green.

“...I don’t understand.” Suni said, glancing up with worry at Varanus.

Her eyes had settled into a hard glare, but for once he wasn’t the target. She stared at the un-moving image, eyes flickering with ugly yellow anger.

Then, without warning, her hand shot forward into the AR, and her clearances flashed from around her wrist-bands, and the image rolled back.

“When?” She demanded.

“Uh..two hours ago.” Suni said. “That’s when there was a sudden increase in oxygen use…”

The image jerked, to just before two hours prior, and then played out.

No light in the room, then a sliver from an open door. Immediately the light snapped on as it registered a living form, but the Imp did not pause even a second. Its speed blurred its form as it skittered up the wall and onto a shelf, where the silver lid of a jar could just be seen from behind some dusty linens.

The Imp did not even unscrew the cap. It just pushed the jar to the floor, where it shattered, a coating of glowing liquid following almost immediately after.

Suni did not even see it leave, as his eyes were locked on the viscous liquid eating away at the bubble, reliving the memory of the same liquid eating away Dawns wings even as she screamed, guilt and horror welling up and making him lose all sense.

Lady Varanus had no such problem, and she only watched with curiosity as the bubble became clearer and clearer, then popped with a rush.

Suni’s eyes cleared.

He jerked backwards in a completely different kind of horror. “That’s not an ELF!”

The creature revealed was covered in fur, but not the soft fur of a pet or some varieties of Fairy citizens. No. This fur was the spiky, prickly fur that made Suni think of the kind of spiders that still appeared in his nightmares. The long, lanky limbs that scrambled for footing only made the nightmare more clear, and when a head appeared, cropped black hair split by horns and far, far too many eyes for a human face, the nightmare was complete.

Suni screamed.

Lady Varanus just hmmed, as if she had seen such a thing before. “You might not call her an ELF anymore but she was before the bubble.”

“But…”

Lady Varanus ignored him, and flexed her hand, speeding the feed. The clock read only half an hour before other monsters appeared, and now the disarray of the closet made sense, as they wrestled the spider-creature when it tried to attack them.

There was no sound, but one of the creatures spoke to the spider, and it - she - quieted. Tears glittered in her many eyes, but she finally nodded, and followed them when they left.

The light clicked off, and she was gone.

“Wh- “ Suni began.

But Lady Varanus was already swearing. “Damn. I should have known they wouldn’t leave their own behind.”

“What…”

“Oh, please. You’ve seen goblins before. You didn’t really think they grew from spacer-shit, did you?”

Suni shook himself, and tried to think. “No, but...they just stole that ELF. It - she - should have help! Maybe...maybe the techs could reverse it!”

Lady Varanus snorted. “Please. We have enough problems just managing your ELFs and irate Fairies. Don’t forget your purpose. We need to find that potion.”

“But…she was... she was human before the bubble. She had a name. Andrea. We can’t just let them kidnap her like that!”

“Trust me, ELF, she’ll be happier with them than she ever would here. Unless she wanted to live her whole life behind a mask…” It was barely perceivable, but Suni’s whole life depended upon catching the hidden meanings behind words, and he caught the pause. “...she’s better with her kind. We’d just put her back in a bubble anyways.”

Suni turned to her. “...your techs said they would not re-bubble anyone without their consent.”

Varanus sniffed. “A goblin is hardly anyone. They are the exception to all rules, ELF. And they cause more problems than they’re worth. Luckily I know some of their tricks.”

Another twist of the wrist, and Varanus summoned her own AR, dwarfing Suni’s.

“Ah, yes. They still haven’t blocked Roland’s old access.”

Suni scanned the wall of AR videos. “What are you doing?”

“The goblins do rather like to prevent any of their kind being re-bubbled. They have a sleeper-code that alerts them any time anyone falling outside the “normal” template is awakened. As the command was written by the PLUM program, it can override most of our systems. But if you have access…”

Dozens of goblins appeared at once on the screens, and Suni bit his tongue before he embarrassed himself again.

“As I suspected. These Awakenings will not appear on you clever scans. The Goblins will be running counter-code, hiding their presence. That was why you only registered one breather, and missed the three that came to retrieve her.”

“...oh.”

“Well, add these to your map, boy! We need to find that Imp before it does more damage!”

-----------------------------

Suni’s mind whirled, and it was lucky that his code was able to work for him better than his weak human brain. He was furious at the goblins. Hated them. Feared them. Wanted them gone, just like Roland always said.

But...the way Lady Varanus sneered and wrote them off, faster than even ELFs, and didn’t even bother to view her scans to confirm a goblin appearance before adding them to Suni’s list...it was worse even than her treatment of ELFs. He had been able to convince her with only a little wheedling to widen their search. But this...sure they were terrifying, but that didn’t mean that the once-ELFs should be shoved back into bubbles without so much as a warning.

It almost made him root for the goblins, speeding through the ‘net even fast than he could, out to steal their kind from the grasp of the Repository even if that meant returning to a palace that was on high alert for any sign of goblin activity.

He should notify Roland about the presence of the goblins in the castle. Perhaps they could capture some, interrogate them about Dawn’s location, and force them to direct them to their leader. It would be justified, to get the monsters that might even now be torturing her.

But…

Marianne thought differently. She believed that there was more to the goblins, and Lady Varanus had implied the same, in her sneering way. He might not trust Lady Varanus, but he owed it to Marianne, at least, to believe in her decisions.

And while Suni hated goblins, he also could not stomach the thought of turning anyone over to Roland. Not after what Roland had done to him. No one deserved that. If they had really hurt Dawn, things might change, but for now...

For now he followed Lady Varanus’s orders, and let the goblins go.

------------------------------

Chapter Text

Marianne winced as her sister hit another high note. Dawn was singing in the super-sonic. Nice enough for songbirds, impossible to hear for ELFs, but painful for anyone with a hint of super-sensory ability.

It didn’t help that she was off-key.

However, she did look comfortable enough and her room glowed with bright cheery colors rather than the sickly hues that colored the rest of the goblin city. And, when a nervous orderly held up an ancient data-sheet summarizing the contents of the bubble surrounding Dawn’s shredded wings, Marianne was forced to admit that it seemed to contain drugs that matched proposals for hypothetical wing-burns back in the Fairy courts.

Grudgingly, she had to admit that, while perhaps not the best option, kidnapping Dawn had perhaps been the only possibility at the time. Even if only a true idiot could miss the fact that she was a princess and not some regular fairy girl. The Goblin King had convinced her that he was smart enough to think twice about that brazen action, and selfish enough that he might have left Dawn to the Fairies had he realized her true status.

So he, and the goblins, fell from Enemy #1 back to normal nuisances in short order.

It did give her great pleasure, though, to watch her host wince every time Dawn hit a high note. Apparently the King was particularly susceptible to Dawn’s abilities.

She glanced into AR, and wasn’t surprised at all at what she found. Dawn, making grand plans for the best, most perfect wedding ever. Personalized invitations. Guest lists which included all of Mars. Recipes for every palate. And everything colored over with disgusting, saccharine sweetness as she described her hypothetical husband and his charming people in the most gooey, rose-colored yet somehow condescending prose possible.

“...how much of this is getting out?” She asked.

The King pinched his nose. “Much less. No thanks to your...pet.”

Lilac bristled. Both she, Rose, and Orchid had refused to leave Marianne’s side once they had caught up with her. The Bog King certainly had not made a good impression on them, and the feeling appeared mutual.

“I’m not giving up communication with the ‘net.” She said as she crossed her arms.

“...fine. Cry to your daddy as much as you want.” The king growled. Marianne glared as he continued. “We’ve blocked most of her outgoing correspondences and slowed the in-coming as much as possible. Not that our techs have much experience stopping a flood.”

He sighed, and for the first time Marianne realized just how tired he looked.

“We’ve made an official statement. Not denying what your sister has said. Just suggesting it to be part of the negotiations. That will keep her reputation intact until she’s sensible enough to repair it on her own.”

Marianne blinked. That was rather astute political reasoning, from a man who looked more like a cockroach than a sentient being.

He caught her expression. “Surprised, princess? Just because I’ve no truck with your pretty ways doesn’t mean I don’t know how they go. She’d have been fine if she’d just stayed quiet, but this is the best I can do for her now. I don’t envy her having to stem the claims that she’s slept with me.” He shook his head.

Something in his expression, or perhaps her own thoughts of a creature like him bedding any fairy, forced her to change the subject.

“I have spoken with my father. He agrees that she shouldn’t be moved for now, and he wants her home just as much as I do, so I trust him on that. He’s sending one of our own medical teams over. They should arrive in a few days. Until then, the Field Research Center wishes to coordinate care with your doctors.” She held up a instant connection code with the team’s over’net link.

He blinked at her for a moment, then his eyes unfocused and the code transferred.

“...you don’t have AR up, even in your own home?”

He seemed surprised by the question. “What of it?”

“It’s just…everyone else seems to have no difficulty with it.” It was true. If she glanced into the networks, Marianne could see most every goblin with at least some connection. Within the hospital alone doctors and nurses moved in a haze of charts and checklists and instructional examples, while cleaners walked through the halls handling their Snufflers and other cleaning tools with AR tethers, and patients relaxed to sights and sounds only they could see. Perhaps their connection to the ‘net was not as strong, but it certainly was still present.

Except for their leader, who clearly had all the abilities of a Martian, but needed prompting to use it.

“Your AR is a pretty tool, princess, but I have no need to hide myself in fantasies.” He spat the word out with clear bitterness. “They can’t hide the truth.”

Marianne’s mind shifted to Roland, and the cloud of lies he lived in. If what the goblin king said was true, she’d have never fallen for him, nor would have the rest of the world. But that very attachment to - not fantasy, but rather a smoothed over reality, all the ugliness buffed over and hidden by a pretty sheen - was what gave her once fiance his power.

She drew her mind back to what the King was saying, once again tempted to use less AR, even if she was not completely convinced by his argument.

“...will be working as soon as the connection is made. Some of my less...disturbing goblins will wait for them on the surface and guide them through the Underground. Until then you may remain with your sister, or return to the castle.”

“That’s it? I’m stuck here?”

The King’s eyes narrowed.

“Forgive me, princess, but I’m not about to give an enemy agent free reign of my kingdom while there’s an army on its way here.”

She opened her mouth to argue, but had little to say against that. There was an army on the way, and nothing but Dawn handed over without fuss would prevent something horrible happening. And Dawn had only made such a horrible outcome all the more likely with her mad ramblings about weddings. The best thing that Marianne could do for peace was stay out of the doctor’s way and soothe things on the ‘net as best she could.

But she didn’t have to like it, and she was about to give the King a piece of her mind anyways when she was quite thoroughly interrupted.

“Bog! You didn’t tell me that you had found another lovely lady!”

The look on the King’s face almost, almost, made up for all that came before.

“...mother.” His voice ground with his teeth, and Marianne glanced down to where he was glaring to find a plump goblin with bright red hair and a ridiculous nurse’s outfit.

“And another princess to boot!” The woman grinned wide, and Marianne quite quickly realized that the little woman’s mouth was wider than Marianne’s whole head.

She swallowed, but the goblin woman kept pattering on, turning to her apparent son.

“And look at her, Bog! She looks like she’s flown half way round the world, and you haven’t even gotten her a seat, much less a comb. Poor thing.”

She patted as high as she could reach on Marianne’s arm, her touch cold and clammy, and slightly damp.

“Griselda!” Dawn sat up straighter, grin nearly as wide as the woman’s.

“Ah, pet. Have you been sleeping like I told you?” She bustled up to Dawn’s chair, humming along with Dawn’s supersonic song, and adjusted a few dials on the machine.

Dawn shook her head. “No, Griselda. I meant to. But my sister’s here, and she’s going to steal Boggy-bear away from me!”

“Boggy-bear” dragged a hand down his face, as if to wipe away the embarrassment, and shared a long-suffering glance with Marianne.

“It doesn’t matter how many times I’ve told her no. It just doesn’t stick.”

“What are you talking about, Boggy? You love me. And I love you! And we’re going to save the world together. Isn’t that right?” Her hands reached out towards him, and he carefully stepped out of their reach.

“See, Bog, she likes you.” Griselda beamed, and both Bog and Marianne winced, though for very different reasons.

“Don’t push your luck, old bat.” Bog grumbled, but there was enough affection in his voice that Marianne realized he was fond of the older woman, despite his exasperation.

“Well, if you don’t believe in love, you might believe in politics.” She grumbled back at him. “Even if your hosting skills could use some work. Thang!”

Marianne winced again, this time at the shout, though none of the other people in the room seem surprised. A second later, the frog-like goblin Marianne had seen close to everywhere appeared around the door.

“Yes, Griselda?”

“Are there snacks back at the castle?”

He smiled, and looked up at his master and Marianne. “There can be.”

“Make it so, Ensign.” She gave an imperious wave, ruined by the mischievous glint in her eye. “And get the guest room prepared.”

“Ay-ay, Captain!” He bowed, and backed out of the door, one hand already flickering with commands to his AR.

Then Griselda turned upon her son again.

“Well? Take the nice princess back to the castle and impress her!”

“Mother. She’s right here.”

Marianne interrupted. “And ‘she’ isn’t going to leave Dawn’s side. Not until I’m sure you aren’t doing something terrible to her!”

Griselda sniffed. “Really. And would you be able to tell if we were?” Marianne swallowed. “That’s what I thought. Anyways, if we wanted to mind-control her, we’d have done it already. And done it better, I might add. You can’t even hear how irritating she is.”

Dawn pouted. “You said you liked my song.”

Griselda patted her foot, the only thing she could reach with the chair sitting so high.

“And I do, my sweets. But you could be a bit nicer to the lights. We keep having to replace them.”

“...oh.”

“Now don’t you...ah, there go the water-works. You’d think she’d never been sick before.”

“She hasn’t.”

“Eh?” Griselda glanced back at Marianne, who was watching her sister, worry replacing hostility, hands wrapped around herself.

“Dawn. She’s never been sick. Or hurt. And hardly ever sad. It’s part of my job to protect her from all that.”

“You’re making her live in a fantasy, then.” Bog’s voice was gruff, but his expression soft when she glanced up at him. He, too, seemed fond of Dawn, despite all the pain she was putting him through. “That’s no way to live.”

“...you know, I said the exact same thing to a friend, just before coming here.” Marianne said. “Maybe I should have listened to my own advice.”

Griselda sniffed. “Not much you could have done to prevent this, my girl. But it’s certainly hard to let them make their own choices...”

“Mother, you let me touch a stove when I was two.”

“And you learned, didn’t you? Tough love! Works wonders. Speaking of...do I have to get her singing again for you two to get some rest? Back to the castle with you both!”

She waved a hand, and a wall of force shoved both Bog and Marianne back, towards the door. The Goblin King tried not to trip over the smaller fairy, but there was little he could do not to touch her when the door was only so large.

Marianne shivered as she felt her skin scrape against his armor, and had to fight down her curiosity when he jumped back as soon as they were through the door and the field dispersed.

“Sorry!” He said quickly, wings buzzing in agitation. “She’s rather…”

“Don’t apologize.” Marianne paused to brush the dust off her pants, mostly as an excuse not to allow him to see how not disgusted she’d been at the contact. It was difficult to hide emotions in front of someone who could always see one’s true face. “It must be nice to have your mother around.”

“Oh. Um.”

Mentally, Marianne kicked herself, as the King’s wings buzzed harder.

“I shouldn’t have - “ They both began, tripping over each other’s words.

Bog, who had slowly gone from The Goblin King to just ‘Bog’ over their conversation in the hospital room, gestured for her to continue.

She shook her head. “I didn’t mean it like that. Your mother is...unique.” He chuckled at the careful descriptor. “I’m glad my sister is in her hands.”

Bog scratched the back of his neck. “Aye. She’s one of the best doctors we have, never mind that outfit she wears.”

Marianne chuckled in turn. “Was it normal for ELF nurses to wear those outfits?”

He snorted, and began leading the way out of the maze of the hospital. “Not for a hundred years before the fall, no. She says it makes her legs look good. I think it makes her look like an idiot.”

Marianne’s chuckle turned into a guffaw. “You sure she doesn’t do it intentionally to embarrass you?”

“Oh, I am 100% sure she does it for exactly that reason.”

They turned a corner, and Bog waved a hand to unlock a side door which in turn opened into the cavern.

“You don’t…” Marianne paused, then tried again, careful to get her mind straight before she tried to fly. “You don’t have to worry about mentioning my mother. It’s been 50 years. Dawn doesn’t even remember her.”

“I do.”

She glanced at him quickly, and found him fiddling with his scepter, looking down.

“She was amazing, The Queen. We - the goblins - owe her a great debt. I do as well.”

She blinked, trying not to be won over by his sincerity.

“She wanted to do so much more.” Marianne finally said. “Maybe...maybe we can use this whole situation to try to make things better. For both our peoples. I think...I think it would make her proud.”

He smiled cautiously up at her, uncertain as she was, and Marianne was struck by just how blue his eyes were, despite the shadows and crags of his face. It was clear hope was not a common feature of such a face, but it flickered there, nonetheless, and Marianne decided to give the goblins one more chance.

----------------------------------

Chapter Text

The flight back through the goblin city was not nearly as terrifying as the earlier flights. Partially it was the company of her AI servants flickering at Marianne's side, Rose ready to take down any dangerous creature moving too close to her mistress while Lilac and Orchid scanned and mapped any possible threat. Part of it was the King of the Goblins at her side, for surely nothing would attack a King in his own home (oh, how wrong she was).

But mostly it was the knowledge that, despite all appearances to the contrary, the people living within the city really were no different than the ELFs and Fairies of the upper world. The fearsome Bog King had a mother who hassled him about getting a girlfriend and eating right. Below her people shouted and laughed, and as she flew there was the scent of cooking and the sound of music.

The roller coaster her emotions had been on since she’d received the news of Dawn’s betrothal evened as well. Dawn acting impulsively and doing something she thought was a good idea, causing untold damage and chaos in the process, was so completely like her sister that Marianne should have considered it before going on the warpath.

Not that she felt particularly guilty about attacking the Goblin King. He’d given her the first real fight she’d had in ages, pushing her to her limits, and then past them as she tried to learn every one of his sinister tricks.

It had been glorious. And if she had not been so worried for her sister, she likely would have had fun.

It figured that she had to fly halfway around the planet and find the worst monster known to Fairy to actually get some enjoyment out of life.

“Careful where you’re flying, tough girl.”

Marianne jerked back to reality, just in time to narrowly avoid crashing into a stalactite.

“You didn’t see that!” She hissed, flushing in the darkness.

“See what?” He quirked a crooked smile, and she shifted her wings and dropped closer, kicking herself for getting so far away from her guide.

The flight from the hospital back to the castle was not long, if one could fly straight. But there were few truly straight paths through the underground, even here in the largest cavern of all Mars. Beyond the obvious, massive trunks, there were also elevators that glowed and constricted around their cargo, vines and roots hanging from the ceiling, and buildings of a thousand different styles growing up from the ground and down from the ceiling in equal numbers.

Normally, the higher one flew, the easier a trip became, but here it was far from the case, and Marianne followed after the Goblin King carefully after her near miss.

She tried not to flinch at the buzzing cacophony of life - mostly insectoid - around her. No matter how much it made her skin crawl, she had promised herself to give the goblins a chance, so that’s what she would do.

But as they flew, the chaos around her never seemed to simplify down to any true order. It was all too...jumbled. They spent a minute stopped in a crowd, of which none of the hovering goblins seemed to recognize their leader, waiting at an archaic stoplight for a swarm of half-insect, half-bird creatures to pass by, kept in check by dragonflies barely longer than Marianne’s arm, but with vicious teeth they were happy to use to snap at their charges or any passerby that got to close. The light only turned when the insect’s master passed by, a fat, slug-like creature that rode a floating fish and whistled through AR to give his commands.

Then they flew free over a stretch of water larger than any Marianne had seen outside the palace, but covered in thick scum that long-legged goblins waded through, picking up strange glowing things that pulsed angrily when disturbed. There seemed no obvious order to what was deemed fit to be added to the baskets on the goblin’s backs, and what was thrown back into the water.

They flew over warrens of honey-comb houses just like the ones in the mushroom city, dodged around homes that floated like balloons, and slipped beneath upside-down streets where goblins seemed just as likely to be walking on the ceiling as any other surface.

The trip only took ten minutes, but Marianne felt as if she had seen ten centuries pass before her eyes, all out of order. It was with some relief that she landed beside the Goblin King and was able to put the mad capital behind her, though a pounding headache brought on by flashing lights and the constant roar of voices took up residence just behind her eyes.

“How do you stand it?” She asked, grateful when the side-door they entered through closed behind them.

“It’s not normally quite so...loud.” Bog admitted. “The evacuation has made things worse.”

Marianne blinked, pulling herself from the blessed quiet of the softly glowing corridor they walked down.

“Evacuation?”

“You’ve got an army coming to rescue your sister, or did you forget?” The sneer was back in his voice, and she was surprised to find that she felt a stab of guilt.

“You can’t be thinking of evacuating an entire city! That’s…”

He snorted. “We’re goblins, girl. Most of us came out of our bubbles with the memory of the fall of Earth fresh in our minds. After that, picking up and moving a few tunnels over seems small.” He shrugged. “I wouldn’t say that it’s easy, but we’ve prepared for this. Anyone sensible has their own escape plan, and anyone foolish is coming back just to get a crack at the Fairy Bastards.”

His wings rustled in irritation, and he sighed. “Nothing I can say would change that. All I can do is mitigate the damage.”

“Not much of a King, are you?” The words were out of her mouth before she could think, and she quickly wished she could kick herself for them. Worse, she couldn’t even blame exhaustion or worry for it - she was just that bad at being politic when flustered. Why couldn’t she have been the one with the potion-burns and Dawn the one here acting as diplomat.

But the Goblin King just snorted. “You really don’t know much about us, do you?”

She shook her head. “But...I’d like to learn.” Concentrating, she tried to think of what Dawn would say. “I know...I know we have treated your people poorly. Perhaps there was a reason for it in the past, but I see no reason we can’t take this horrible situation and try to make something good out of it now.” She swallowed, but kept going. “I know you have no reason to trust me, or anyone else of Fairy, but I hope that the good will your people had for my mother might extend to my sister, if not to me. And I wouldn’t be here if I didn’t think there was some way to solve this without bloodshed. And you must feel the same, or your actions back in the castle would have been…”

She trailed off, blinking at the room Bog had brought her to. Compared to the absolute chaos outside, this place was the epitome of comfort. Warm yellow light, so like that of earth, bathed the whole room. The walls were slightly rounded, as were the doors. No windows, but an illusory blue fire flickered in one wall, and a plush rug covered most of the wooden floor. And…

“Are those puff-ball cushions?”

“Eh?” Apparently the Goblin King had been listening closely to her speech, because her abrupt change surprised him almost as the room surprised her.

“I haven’t seen these since I was a kid!” She nearly squealed, and dashed forward.

“Don’t - “

But the warning was too late, and would have been ignored anyway. The Princess threw herself forward, giggling, and dropped her weight on top of the ottoman.

Immediately perfumed dust erupted around her, sending her coughing even as a fine brown powder coated everything around her. It smelled like musk and sandalwood, far deeper than the airy perfumes of her childhood, but the feeling was the same; the softness of the cushion, the overwhelming scent, and the glorious feeling of doing something just a bit naughty with no real consequences.

She turned, still splayed out on the deflating cushion, and caught sight of her companion.

He was covered in dust, head to toe, and wearing the most startled expression she’d yet seen; mouth half open, blue eyes wide, as if she had done something completely impossible.

He looked like a complete idiot, but the laughter that bubbled up wasn’t directed at him.

Her world was at war.
Her sister was crazy.
Her ex was set on ruining her life.
And her worst enemy was every bit as scary as she’d been told.

But there were puff-balls, and super-sonic singing, and that very same enemy looking at her with shocked blue eyes, and the world couldn’t help but dissolve into something even more impossible.

When, a second later, he laughed as well, something clicked, and - for just a moment - the world felt right.

Chapter Text

Adding the goblin kidnappings to the list turned out to be the last thing Suni needed to get an idea as to where the Imp was heading.

The line was not particularly straight: it wavered and darted back and forth as the Imp sensed new bubbles to pop: but the creature was moving steadily Eastward through the castle. It seemed to be sticking to the lower floors, exactly as Suni had predicted, only shooting up when there was a hidden closet like the Chapmans’ holding hidden servants. It made sense - the lower floors were hard to navigate with AR on, but without it much of the under-croft was giant open spaces where one only need take a few steps to disappear behind screens or plantings. There was also little danger of someone with overrides being able to find the Imp by looking through AR, and the few people like Suni who functioned without it would likely not consider the Imp unusual - there were far stranger pets skittering around, and it was best not to question, especially given how bubble-happy the Fairies had proven to be.

Suni scolded himself for being uncharitable. Two hundred ELFs bubbled unfairly across half the castle was not all that many, when one considered the near 1700 year history of the castle. Seemingly the taboo had held, except in horrific, but rare, cases. Some might even have been genuine accidents, as bubbles stored in cupboards and on top of shelves could be lost as easily as anything else. Or they could be maliciously hidden by ELFs just as easily as Fairies. Suni’s on family had done essentially the same with his Father, shoved into the very back of the Bubble Repository with the instructions to ignore completely when it came to deciding which family member to bring back next.

Part of him wondered if he was giving the Fairies too much credit, but he silenced that part of himself and simply focused on making his map the best he could. Time-stamps, locations as accurate as he could make them, predictions on the route the Imp would take next…

He checked and rechecked, but still it didn’t make any sense.

“...Lady Varanus?” He called out, and jerked the Fairy out of her own AR stupor.

“What, ELF?”

“...this data doesn’t make any sense.” Before she could tear him apart for bad math he added, “It looks like its not going towards the Repository at all.”

“Really?” Varanus looked into the map he held out, and focused on the proposed path.

“See? There’s nothing important in that direction. Nothing that’s been used for centuries…”

He glanced up, and saw Varanus’s yellow-green eyes wide. For the first time, he sensed horror on her face.

“No.” She whispered.

“...Lady Varanus? What’s over there? What - “

“We have to leave. Now.”

-------------------------------------

Suni had thought he would be running.

Lady Varanus surprised him. She had thrown all propriety to the wind, and simply picked him up. It was for her sake, not his, that he threw up a shield and hid himself as she shoved him beneath a remarkably sharp arm and bolted through the castle.

She was not as fast as Marianne. She couldn’t hit supersonic speeds, and she still suffered from some restrictions to her sight that prevented her from taking the most efficient route through the castle.

But as Suni watched, she sped straight over the path he’d charted of the Imp’s progress, not hesitating a moment even as he sent message after message to her team noting them of new de-bubblings and warning them of lurking goblin adversaries.

Then, she passed over the last location Suni could find of the Imp. And she didn’t stop, even as he struggled to shout at her to slow down, look for the white rat, think a moment.

She kept moving, on into an area that Suni had never even seen, a floor on the very outskirts of the castle, just barely above ground, on a long edge that lead to one of the shield towers (Roland’s, if Suni had stopped to consider it, but he didn’t) and pristinely clean despite no indication of Fairy or ELF habitation for at least two centuries, if not more.

“...ady Varanus!” His voice was carried away by the wind, but he spoke through AR directly to her mind. “Lady Varanus! Slow down!”

“Not until we ensure it hasn’t broke through!” Came her shouted answer, and they sped on for another two minutes, before she stopped as fast as she started, leaving Suni to be thrown from her arm when she stopped before a blank, nondescript wall without even a hint of AR about it.

She sighed in relief. “It’s not here, yet.”

“...not at a wall?” Suni picked himself up and squinted at the wall, trying to understand what was so special about it.

They seemed to have flown into a research wing of the old castle, long abandoned, likely because whatever it had been built for had been deemed unnecessary and forgotten about by all but Lady Varanus. The whole wing seemed full of such projects, with fading AR not unlike what Suni remembered from around PLUMs room, but with far less dire warnings. Blank white walls, interspersed with light panels, simple tile floors, easy to clean and completely nondescript. Nothing to indicate why Lady Varanus stopped here, rather than before any of the hundreds of other laboratories.

The only thing he could figure was that the entire wall had no doors at all. The corridor they had flown down seemed normal enough, a bit like the quiet underground beneath the repository, with a clean, professional look to it : well lit, regular snuffler patrols, turnings where ever one would expect them to be. The only odd thing was the left wall. The right had the normal number of doors, spaced regularly every hundred feet or so, but on the left wall, there was nothing. No reason at all to stop a this spot, rather than any other on the thousand feet or so of blank, white stone.

Suni glanced back and forth through his glasses, but there was no difference, which in itself was a little odd, as usually there was something. But even the over’net seemed a bit weak here, likely because there was nothing at all that needed.

“...why would it come here?” Suni asked, when Varanus had caught her breath.

She stood up again, and brushed the dust from her dress. “You are not cleared for that information.”

“What?”

“However, you have been cleared for a new mission. Forget finding the Imp.”

“Eh? But Dawn! The Potion!”

“The Imp will come here. I am certain. Our job, now, is to prevent it from going any further.”

“...o...kay?”

Suni swallowed, and looked up and down the corridor. Still no change. All his sources indicated that the Imp was still a good hour of work away from this edge of the castle.

Yet Lady Varanus stood, arms crossed, face pale, and stared down towards the rest of the castle, as if she was expecting hell itself to be coming towards her.

It made absolutely no sense.

Chapter Text

They had waited half an hour, Lady Varanus vibrating with worry, wings buzzing like the summer cicadas from Suni’s childhood. Suni watched for the Imp over the rims of his glasses, knowing the creature knew how to use AR, but he couldn’t help but notice that while indeed the appearance of the de-bubbled, both Fairy and ELF, and even some goblin, did continue getting closer to their location, it was not as straight a line as Lady Varanus seemed so certain of.

Finally, he spoke.

“Lady Varanus?”

“Silence, Elf. We must be vigilant.”

“...right. I just noticed that there are still de-bubblings happening. Quite close by, if you measure by true distance, rather than AR maps. There aren’t...any other entrances to this place?”

“No. This is the only entrance.”

“No...secret tunnels? Some kind of AR shield, like back in the Chapmans’ chambers, hiding a ventilation shaft or unsecured closet?”

She glanced at him, and he realized she’d never seen the ancient movies, and didn’t know the reference. Dawn would have.

At the thought, he sunk back into silence, trying not to think too hard. When he’d been helping Lady Varanus and the Repository Techs, he hadn’t had enough time to think, and it had been nice to have something that could keep the guilt at bay. Now there was nothing but him, a terrifying Fairy, and his own thoughts in the long, empty corridor.

He still helped the techs as best he could through AR, trying not to bother Lady Varanus’s vigil as much as possible. Still…

“There’s been a de-bubbling just eight floors down, right below us. If we hurry…”

“We stay.”

Her tone allowed no argument and he settled down again.

Then -

“There have been some de-bubblings further out. Past where we are right now. One even got some goblins involved…”

Lady Varanus remained silent, her only indication that she heard him at all a shift in her stance, so she could see equally both ends of the corridor.

Fifteen more minutes passed, and Suni resisted the urge to bounce on the balls of his feet.

“I think it’s climbing the tower, now. Some of your tech’s need higher clearance, to go into the private chambers. They could probably use our help…”

“It’s a trap.” Varanus said. “It is trying to draw us away.” But she waved a hand, providing her people the clearances they needed to invade the dignitaries rooms.

Suni waited, watching his screens and doing his best to scan the hall, just like Roland did when he actually cared to watch the Princesses. But he watched as the de-bubblings traveled up and up the tower, higher and higher.

And then - stopped.

He blinked. One hour had gone by. Perhaps the Imp had tried to draw them away, and it was even now advancing back to their location, ready to uncork its mischief on whatever strange secret that Lady Varanus was willing to look like a fool to protect.

Another hour ticked by. There were no further reports of de-bubbling, though there had been reports of goblins attacking techs in the process of transporting the less attractive changed ELFs back to the repository. Glancing at the changes, Suni wondered what, exactly, classified one as a ‘goblin’. Soft fur on the face had been fashionable once a few centuries before the princesses had been born. And so what if one’s wings came out less butterfly or bird-like, and more clear and veined like an insect? He would have considered any with wings a Fairy, even if they did have an extra eye or a few horns.

It was still no excuse for the goblins to hurt the techs, dispatching them with enough violence that it made Suni sick to his stomach thinking of Earth (or worse, Dawn receiving one of those blows).

But Lady Varanus did not move. She stood like a stone, watching, waiting. For what and for why, Suni couldn’t even begin to guess.

Then…

A message came.

Suni blinked. It was simple, just a tied scroll with a flashing purple arrow to encourage him to open it.

He remembered Roland’s attack. He remembered Varanus’s warnings.

He opened it anyways.

Inside, the Imp sat, with a single black bubble in its claws.

Beside it, the potion sat corked, only a third or so of it used. A third of a bottle, all that was needed to start a war and Awaken two hundred souls.

It smiled, and waved. And that was it.

When Suni closed the message, a purple marker, in lurid sparkles, had been added to his map. A small repeating image, of Suni and Lady Varanus ascending the tower, repeated over and over again.

But he didn’t need it to know where the Imp was.

He could recognize that carpet anywhere. Only one man in the galaxy was garish enough to still have a Toreador rug.

-------------------------------------

Suni steeled himself, and clutched the Imp’s message in a metaphorical hand.

“Lady Varanus?”

She did not even glance at him, but he knew she heard.

“I’ve received a message from the Imp.”

“Disregard it. It will lie to get what it wants.”

“I don’t...I don’t think it is. I think...I think it’s done running. It knows I’m with you and it seems like it wants to talk.”

“Don’t fall for its lies, Elf. You may have met it once, but my people have fought it for fifty years.”

After all he’d done to help her, and all the time he’d waited, nerves jangling in his skull, Suni felt hurt that she dismissed his words so quickly. She showed absolutely no interest in looking at the message, even as he sent it over to her.

The Suni of yesterday would have remained patiently waiting on her. But the Suni of today was tired, worried for his best friend, and tired of all of his companion’s quiet cruelties.

So he did something impossible.

He spoke out. “You may be right. It could be a trap. But I won’t sit here, doing nothing, while Dawn is out there in danger, and the Imp is right above us in Roland’s room, ready to give over the potion. If you want to stay, fine, but I can’t give up this chance to make things right.”

He turned, not envying the trek back to the nearest lift, when Varanus spoke.

“...did you say Roland’s room?”

Chapter Text

“Oh, I needed that.” The fairy princess - Marianne - said, as she wiped tears from her eyes.

Bog didn’t mention that the tears had seemed just as strong as the laughter, in the end, but he hadn’t the right to judge. He had felt the same impossible relief at the thought that there might be some hope after all in this mad situation, and the laughter had brushed against all the darker emotions he had been trying to ignore, ever since the moment he realized just who he’d kidnapped.

He leaned back against the cushion she’d collapsed on, eyes tracing familiar patterns on the ceiling, and wondered if his own tears showed. A surreptitious swipe of his eyes showed that at least he hadn’t been crying blood. The Fairy Princess had been able to stomach the goblin capital surprisingly well for one raised in the ordered surface world, but there were some things even she might not be able to stomach, and the sight of some of the stranger quirks of his anatomy might frighten her right back to the sword.

“Ah! You aren’t fighting! Excellent!”

Thang strode through the door, Stuff hurrying behind him, both carrying platters. Of course Thang hadn’t stopped to knock on the door, but the little creature rarely stopped to think about anything he did, so it was no surprise to Bog, at least.

What was more surprising was that the fairy girl didn’t seemed shocked at the lack of deference. She just sat up and looked curiously at the food that was placed before her.

“Griselda asked me to make sure you both ate something, then went to bed. In her words…”

Thang nudged Stuff, and the bigger Goblin pitched her voice to match the matriarch “Nothing’s going to happen in the next five hours, so get some sleep. We’ll wake you if something interesting does happen. Which it won’t if I have anything to say about it. Until then, try to be a good host.”

Message done, the bigger goblin glanced at her partner and muttered “was that right?” to which she received an enthusiastic grin. Their whispered conversation continued as Bog turned back to Marianne. “But I left out the bit about smooching…” “trust me, that was the right call.”

“I’m afraid our hospitality might not be quite up to your standards…”

Marianne shook his words away with a gesture. “Puff-ball induced hysteria aside, I really did mean what I said about wanting to learn. Your city might be a bit...much, but this seems a more manageable dose of culture shock.”

She crossed her legs and cinched in her purple wings, and leaned forward, examining the floating trays.

Thang, and whatever chef had been in the castle kitchen, had tried for something the girl might at least find palatable. They’d assembled a plate of fruits and vegetables that, while far from cutting edge, were at least just as common now as they had been before the Earth’s fall. Apples, grapes, sliced cucumbers and tiny sweet peppers, along with slices of cabbage dribbled with a dressing and cubed soft yam; they were all staples that had existed 2,000 years before Earth’s fall, and still existed 2,000 years after.

But instead of going with the familiar, the Princess critically eyed the grey puree squeezed across a slice of hard cheese, then steeled herself and popped the whole thing in her mouth.

Bog watched her expression carefully as she chewed, then nearly bubbled Stuff on the spot when she whispered “Does she know that’s grub meat?”

Marianne clearly heard.

She swallowed, slowly, and and turned to a suddenly stricken Bog.

“What is it the ELFs say? Tastes like…”

With some relief Bog answered “Chicken. Everything tastes like chicken.”

“Funny, because ‘skeeter-chicken tastes nothing like Earth chicken.”
“Really? You’ll have to prove it.”
“Happily. There’s a bar in Bugvill that has the most amazing skeeter barbecue - “

“Thang.” Bog warned, and the whispering behind him quieted. “I’m surprised you know the reference, Princess.”

She shrugged, and proved her courage by choosing a different offering from the bug-plate.

“I had a friend, growing up, who was - is - an ELF. He told Dawn and I everything he could about Earth. All the stories, all the culture, everything he could think of.” The fairy smiled, clearly at a fond memory, before continuing. “The thing was, he only spent four years on Earth before the fall. He learned it all because we kept asking questions, and he didn’t want to disappoint.”

She shook her head, then selected the next offering.

“...would that be the ELF that started this all? The one in love with your sister?”

She looked up sharply. “His name is Suni.” Then she softened. “But yes. I’d have never thought he’d have it in him to steal a dissolving potion, though.”

Bog raised a brow. “Really? You’ve only said three things about him, and already it makes perfect sense.”

“Oh?” She considered. “How so?”

“He adores your sister. He would do anything to please you. And he’s clever enough to survive the underground. The real surprise is that he didn’t do it sooner.”

She blinked. “...huh. I would never have thought about it that way.”

A frown creeped on her face, and Bog quickly added, “Of course, you wouldn’t. You’re not the kind of person who would use it. Even if you did believe the Sugar Plum about it being a love potion.”

The fairy princess looked up, far too much consideration in her eyes, and for a moment Bog was terrified that he had said too much.

“Did someone call for me?”

Just as quickly, those too-clever eyes jerked to the mirror above the fire, and Bog swore for a completely different reason.

---------------------------------------

“Oh. It’s you.”

The sneer in the voice, and the hazy static that swarmed around the mirror in AR the moment the figure appeared told Marianne all she needed to know about the identity of the new guest.

“The Sugar Plum Fairy, I presume?”

“In the flesh. Or, well, as close to the flesh as an AI trapped in an eternal void can get. Let me guess, you want to beg for my assistance in healing your sister.”

Marianne blinked. Until that moment, she had not considered asking the Sugar Plum Fairy for help. Nor had she even thought about speaking with her, for all that several of the generals had privately begged her to find a good map to the AIs true location. She might have started this whole mess, but there was absolutely no indication that she would be any help in solving it.

“Well, you won’t get it! Not after what your mother did to me! Not even if ~*~Boggy-woggy~*~” The king winced at the sing-song bastardization of his name. “ - were to beg on his knees and apologize for all the wrong he’s done to me!”

“...right. Can you even help my sister?”

Plum froze, mid-gesture, finger pointed menacingly out of the mirror, while behind it her mouth searched for words.

Marianne didn’t allow her to find any. “Because as far as I can see, you started this, but you don’t have the ability to fix the fields you’ve broken. Unless you have abilities far beyond what was recorded during my mother’s time, all you can do is break, not heal. And even if you could help, the price would be your freedom. After the last time you went crazy, why do you think anyone would let you out?”

Plum’s mouth dropped further, as did the Goblin King’s.

“You...you know why your mother banished her?”

Marianne shrugged. “Well, I didn’t, but I had a lot of time to do some reading on my way over, and I read about all your trouble-making. Stockpiling dissolving potions until you could flood the whole repository? Intentionally altering awakening conditions, just so bubbles would unravel before anticipated? Causing who knew how much harm by intentionally creating damaged bubbles? Why in any reality would I ever want to work with you?”

Plum’s mouth snapped closed, and she hissed. “You are exactly like your mother!”

“I’ll take that as a complement. Until then, I’m following another mother’s directions, and getting some sleep.”

Hastily, Thang threw a map to the room the goblins had prepared for her into her AR, allowing her to flounce out of the room without a hint of hesitation in her steps.

Maybe the goblins didn’t deserve her ire, but Sugar Plum certainly did, and it felt remarkably good to give someone a piece of her mind.

----------------------------------------------

Bog watched the Crown Princess of Fairy leave, all regal posture hiding a wicked grin he’d just barely caught a glance of before she’d left the room. He’d wanted to dress down Plum like that for years, but he still needed her, if he had any hope of de-bubbling more goblins.

But Marianne...she had no reason to respect the AI, and no dependence on her. Of course she’d see the casual insults and mind-games the creature played as despicable and cut right through them. He was impressed.

“Oh, don’t look so love-struck. You know she’ll never fall for you.”

Or perhaps Plum’s tricks didn’t work on the Princess because she had no ammunition for her cruelty.

He turned towards the mirror. “That was uncalled for, Plum. The Princess is here for her sister, and to stop a war. Romantic entanglements are the last thing on either of our minds.”

“Hmpf. You only say that because your mind hasn’t caught up to your heart yet.”

“Plum, why are you here? You know very well that I didn’t call for you, no matter how much you twisted your code to get in.”

“Maybe I just wanted to check upon you, and the castle is the only place I’m allowed into.” When Bog rolled his eyes she added, “And I have updates on the movement of the fairy army. I’m sending those on to your intelligence division now. And…”

She paused, her form losing its clean lines as her mind dithered.

“...And to reiterate that our truce still holds. Roland leads the Fairy Army, Bog. You can play at diplomacy all you wish, but the fact still stands that he wants this, and there is little you or I can do to oppose that. And…”

She was barely a face in a cloud, now, turning into the magic mirror of a fairy tale, even as her words were far worse than any a silly story could imagine.

“He’s not just coming for me, Bog. You have his Princess. His ticket to the throne, the one he has traveled across time for, the one he has molded to his will; everything he needs for his dreams to come true. You cannot win against that. Don’t risk us all pretending you can trust her. She’s his creature, for all that she pretends otherwise.”

Bog glanced at the empty door, feeling the gulf between the strong-willed woman he had spent the evening with and the creature Plum described.

“No. You have let your hatred of her mother blind you to the power she wields.” Then, before Plum could argue further he added, “She is not the creature we need fear falling to Roland’s whiles.”

The empty corridor seemed to lengthen, darkness stealing any lingering memory of purple wings, reminding him all to easily of a different time, and a deeper darkness. Of the difference between the independent woman who had wrestled herself from Roland’s clutches…

And the man who could not.

“I am.”

Chapter Text

It was lucky that Fairies did not need much sleep, as a commotion roused Marianne a mere four hours after she had found her room.

She had been asleep the instant she’d hit the mat, collapsing into the thick cushion and forgetting everything for a while. She woke surprisingly well-rested, at a time her internal clock registered at 6.30 am. The accommodations had been...quaint, but the fungal cushion on the bed had been heavenly after a day spent in the air, firm enough to ground Marianne back to reality and comfortable enough to ensure a good sleep.

During the night someone had drawn a blanket over her, and whoever it had been had won Rose’s trust long enough to be allowed close to the sleeping Princess. Marianne briefly pondered who it could have been, but quickly brushed the thought aside as someone ran down the corridor outside, knocking on several of the other doors as they went. Even as her three AI servants spun around her, urging her to get some more sleep, Marianne wiped the sand from her eyes and set out to find the source of all the noise.

Perhaps she shouldn’t have been surprised when, two minutes later, her ears lead her to a chamber similar to the one she had crashed into a day ago. Smaller than a throne room proper, with no glass windows for unexpectedly violent visitors, but clearly used for a similar purpose.

The Bog King sat at a table, his mother at his side trying to force a breakfast at him, while half a dozen goblins all spoke at once, and more still hurried in and out. Thang, the little attendant-goblin Marianne was beginning to recognize apart from the others, was nowhere to be seen, nor was his tubby companion, but there were several goblins of similar shape and size crowded into the room.

It took a moment for Bog to notice Marianne’s presence, as the goblins showed her the same amount of deference as the King himself - namely, very little - as they shoved around her as she paused in the doorway.

In fact, it was his mother that noticed her first.

“Oh! You needn’t be up yet, girl. But if you are, have a pastry. My boy won’t eat - “

“Mother.” He growled, paying little attention as he clearly scanned through a report in AR, then did a double take when he caught sight of Marianne through the screen. “What are you doing here?”

“What’s going on?” She pushed her way into the throng and took a seat opposite to Bog, few of the goblins actually sitting at the table, leaving space free.

“Phaser Beast hassling the evacuees from Rust Ward. One of the major routes is down.”

Marianne blinked. The words seemed to make sense, and the goblins seemed to understand them without difficulty, but it certainly made no sense to her.

“A...Phaser Beast?”

Bog looked up from his report, rolling his eyes. “When a Mommy Cheshire and a Daddy CWWTW love eachother very much…”

Another blink, another moment of interpretation, but this time Marianne could parse it. Cheshires were the huge mutated cat-beasts that had the ability to become invisible, but there were other cat-creatures as well. Cats Who Walked Through Walls - CaWW’TaW for short - were tiny creatures who matched their names. They shouldn’t have been biologically compatible, given the size difference if nothing else, but in the unlikely event of a union...the offspring would have very worrying powers indeed.

She had always thought the phrase 'fast as a Cheshire through walls' was a joke, or a simplification. Apparently not in the Goblin Kingdom.

“And you’re...hunting this creature?”

A nod, and Bog swiped several bubbles off the table and into a storage bag. “We won’t kill it, if that is what you are asking. Just harry it back to its territory. Keep the routes open.”

Marianne considered. A quick glance at the assembled goblins in AR showed them to be some kind of strike force, all with rather nasty bites, wings, or sheer bulk that would intimidate just about anything. But the seriousness that they treated the situation with indicated that the threat was most certainly real, and dire enough that even in a political crisis the King would drop everything to quickly deal with it.

“I’m coming with you.”

That got a better reaction. “Why in the seven hells would I allow you to do that?” Bog spun to her, shoulder plates flaring as he growled.

She shrugged. “I want to help. And I want to see you fight some more. Is that a problem?”

He opened his mouth, then snapped it shut and ground his teeth, and Marianne forced herself not to smile. She’d guessed right. He did need all the help he could get.

“Fine. Don’t get yourself killed, princess.”

--------------------------------------------

The Imp was exactly where it had said it was.

Suni glanced over his glasses, ignoring with difficulty the queasy feeling of entering Roland’s chambers. If there was anywhere he didn’t want to be, it was in the Green Knight’s rooms. Even if he couldn’t see them, he was certain viruses dripped down the walls and traps hovered just out of sight, ready to pounce on the unwanted.

But Lady Varanus simply waved a hand and the door to Roland’s rooms irised open, as if she was one of his current lovers, but with none of the awe in her step as she strode straight through the illusions.

The Imp chittered at them, wide eyes going back and forth between the two, seemingly unsurprised at such an odd couple.

It was as real, as Suni’s eyes quickly confirmed. No trick, just the little creature waiting patiently just beyond the door, black bubble between its claws, expectant expression on its face.

“Imp.” Varanus growled at the thing.

It responded by curling its tail closer round the potion behind it. Then, as if to completely invalidate her authority, it stuck its tongue out.

“Why you - “

“Wait!” Suni quickly stepped in front of her, arms outstretched. “No need to scare it off! We don’t even know what it wants!”

“Oh, we do. It wants to bribe us into letting it go. Letting it make chaos out of everything Fairy has created!”

Suni glanced behind him. The Imp had certainly caused enough chaos already.

“Is what she says true?”

The little creature cocked its head to the side, then held out a hand and mimed a tipping balance, just as it had to explain the Sugar Plum, back what seemed like years ago.

“Kind of true? But not completely?”

It nodded emphatically.

“We’re not letting you go.”

The Imp shrugged.

“We should feed it to a Cheshire.” Varanus hissed.

Its ears went back and it pouted.

“Lady Varanus, lets at least hear it out. Think of it as a truce. If just a temporary one.”

The tall fairy looked down her nose at him, but something in his eyes made her pause.

“... fine. But I keep my offer on the table.” She snapped her teeth, and the Imp flinched.

“...right. Just...give me a few minutes to figure out what it wants, okay? No feeding anyone to anything until then.”

“Fine.”

--------------------------------------------

The hunting party was full of grim faces and strange powers. Marianne had only a chance to scan the list of the names before the full team was suited and ready to go, Bog stuffing one pastry in his mouth at his Mother’s insistence.

The team was made of twenty or so goblins, and equal number flying and non, and they all were outfitted with strange devices and odd garments. None wore armor like Bog, but a few had heavy leather shirts and trousers, while others looked as if they had skin that was thick enough on its own. The most common garment was a thick belt, worn across the chest, with bubble-cages and weapon straps. Yet no two goblins seemed to be bringing the same equipment, if the array of sticks and tablets and gauntlets was any indication.

Marianne was only beginning to parse the purpose of those devices when Bog gave a command, and the group split in two, half going to an empty area of the room, the others going to stand behind Bog. Marianne barely registered that the latter team all had wings before Bog waived a hand, and the non-flying goblins disappeared into black bubbles.

The Princess started, shocked at the casual use of bubbling, but none of the other goblins seemed surprised. Instead, the flying goblins converged on the bubbles, somehow able to tell one from the other, and stowed them in their packs. Bog claimed four of the floating bubbles, and Marianne belatedly realized that the only ones who had moved were the team leaders.

Bog collected the bubbles, attaching them to the silver nets on his staff, and called another order. Quickly, the team scattered, launching themselves from the large window then taking their own path to the city edge.

Bog did not hesitate before he too was leaving, and Marianne had to hurry to catch up.

The way the goblins had moved was nothing like the tactics preferred by the Fairy Army. Roland and the other Generals worked in straight lines and detailed battle plans. This was just chaos.

But it worked. The scattered team re-converged a scant ten minutes later, most arriving at the edge of the city within seconds of Bog and Marianne. They came from all directions, high and low, efficiency by way of each choosing their own preferred path, with their leader trusting them enough to allow such freedom.

No wonder it had been impossible for Fairy to track the Goblins back to their capitol. It would have been difficult to guess from the outside that the whole group was even heading in the same direction, much less had the same destination in mind.

But Marianne did not have much of a chance to consider the strange tactics of the Goblins, because they landed in a nightmare.

----------------------------------------------------------

Chapter Text

A few minutes of pantomime with the Imp, and Suni felt as if he had an understanding of what it wanted.

Even if it made no sense.

“Okay. So. You give us whatever is in that bubble, and in exchange, you want to come with us to the Goblin city to return the Potion.”

The Imp nodded.

“Even though that’s what we were going to do anyways. And the Goblins probably hate you just as much as we do.”

A shrug.

“And you can’t tell us what’s in that bubble.”

Another shrug.

Helplessly, Suni looked at Lady Varanus. “I feel like I’m missing something. Why is this a bad plan?”

“I will not be bribed into helping this creature with its schemes!”

“But...we were going to do that anyways. And its promised that there is nothing dangerous in the bubble…”

“I know what’s in it.”

Suni blinked, and looked up at Lady Varanus. Her arms were crossed and her hands clenched, white knuckled, in the fabric of her sleeves.

When he looked back at the Imp it was nonchalantly looking at its claws, a parody of innocence.

Nothing he had done, in all their time together, had angered Lady Varanus as much as a minute with the Imp. And she was angry, not frightened or scared, or any of the logical emotions Suni could imagine if something truly terrible was hiding in the bubble. Furious, but looking anywhere but the face of her enemy.

And that...didn’t seem right. Of everything he knew of her, Suni couldn’t imagine her ever shying away from something horrible, or ugly, or frightening. She was callous and cruel and unflinching in the face of apparent horror, but she was certainly not a coward.

What could possibly be in that bubble? A weapon? A monster? No. Whatever they had been protecting in that creepy long corridor could have been any of those things, but this was something different.

He looked between the two of them, one frozen in anger, the other pretending nonchalance, neither moving from their impasse…

And a memory of Dawn spoke, through the lens of memory, her words ringing true.

You know, Suni. The only reason you hide a bribe is if you’re doing something wrong. Otherwise it’s just a compromise.

---------------------------

When Marianne’s brain caught up with her eyes, she was suddenly grateful that she had nothing to eat.

They had come down at the exit of a large tunnel, clearly an ancient opening to the higher floors, that opened into a wide plaza. But while the rest of the underground pulsed with constant noise and motion, here there was an eerie silence.

It took a moment for Marianne to understand what she was seeing. There were bodies on the pavement. No. That was not right. There were bodies in the pavement. Goblin forms littered the plaza, some broken, some simply tossed aside, but almost all somehow caught half in, half out of the stone. Some were sunk into the ground, looking for all the world as if the pavement had turned, for just a moment, into water. Others hung from buildings, windows still solid around them, bricks swallowing them up, balconies bowing under their weight.

It was the details that stuck to her mind. A shoe, fallen from a foot, while its partner stuck half out of a vent, as if the wearer had lost a shoe while climbing a stair. A snout, emerging from cracked brick, with the largest crack revealing a still blinking eye. Hands, twitching, stretching from solid stone, as if begging for release.

And in the middle of it all, the Phaser Beast sat, sprawled across the tunnel mouth, relaxed in the way only a feline could be. It was huge, comfortably sprawled across a space that twenty fairies could have stood across, wings outstretched. It had shaggy white fur, and a half eaten goblin beneath a huge paw.

They landed a good block away from the carnage, but even there the beast’s work could be seen, as the fleeing crowds had trampled everything in their effort to get away. There was blood on the pavement, and it felt as if the air itself resisted as they touched down, every motion being just that little more difficult as they pushed through the horror.

Marianne’s hand fell immediately to her sword, and Bog caught her before she could draw it.

“Hold on, Tough Girl. It’s not as bad as you think.” There was relief in his voice as he said it, and she wondered what worse scenario he could have envisioned, if this was “not bad”.

He whistled, and three of the hovering goblins landed.

“Med teams first.” He said, and a small, fly-like goblin removed three bubbles from her satchel. “And find out who’s got the slow-field up. It’s starting to buckle.”

Marianne blinked, and tested the area with a wing. It hadn’t felt like time slowed - it really had. The field was huge, enveloping the whole plaza, slowing time to a crawl for any who didn’t actively fight it.

In a few moments, a flying goblin returned with the one responsible, an ancient troll-like man whose hands shook around the cane he held. His eyes were tightly closed in concentration, and he muttered mantras beneath his breath.

Several more of Bog’s team surrounded the man, both with wings and not, while Bog knelt beside him and reached out a hand to shake his shoulder.

“Honorable Monk, please awaken. We are here to release your burden.”

The goblin’s eyes flickered open, and he sagged in relief. “King. I tried - “

Bog smiled, and patted his shoulder. “You have done well, Jetsun. Sleep. We will take care of the rest.”

The old man nodded, and another of Bog’s team caught him as he fell, finally giving in to exhaustion.

Marianne glanced up, the field barely flickering as the old man’s faded out and was immediately replaced by another. The source of the new field was obvious - three frog goblins sat in a semi-circle to one side, a larger goblin protecting them, all three with looks of deep concentration on their faces. Surprisingly, none of them had wings.

“Fairies and Martain natives almost always develop wings, because that is what they expect.” Bog said, following her line of sight to the frog-like goblins. “But ELFs and Goblins had no expectation that they would have new abilities upon Awakening. Their fields take the shape of their own ideas, whether that be a robe - “ He nodded to the old man, whose simple canvas clothing was overlaid with translucent red and gold layers, shifting like fabric as a cup was held to his lips. “- or armor - “ now that she concentrated, she could see a greenish shimmer around the frog-goblins that almost looked like fairy armor. “ - or even things like weapons or halos.”

“Oh.” She looked around, realizing that more of the King’s team might have abilities than she had first thought. Only half of them had wings, but there was a tell-tale shimmer on many of them. "Is that why the Phaser Beast looks so strange?"

The beast in question was covered in shaggy fur, but from its head came thousands of thin white strands, what would have been whiskers had they not covered the whole head in a mass of prickly white.

Bog blinked, surprised at her question, but grinned a crooked smile and nodded. "Aye. To a cat, all extra senses should come from its whiskers."

"Fascinating. is that why its blind?" The beast had turned its head towards them, clearly hearing their words, but only barely interested in the intruders to its territory. Blank, unfocused eyes raked the buildings, while the ears flicked immediately toward them.

"It's not blind. It simply has no need of such primitive sight."

She was about to ask more, but her question was interrupted by another frog-goblin, this one with a huge throat-sac, scurrying up to Bog.

“Ready, Sire!” There was a mechanical device around his throat, and two of the medics at his side. Marianne realized that most of the rest of the team had been de-bubbled as well, and seemed to be waiting for this little goblin in particular.

Bog glanced around at his team, and then out at the beast.

"Very well. When you're ready, Echo."

The little goblin nodded, fiddling with the dials on his device, then breathed deep, filling up his throat pouch completely before letting out a thunderous tone.

Marianne clapped her hands to her ears, the sound echoing up and down the supersonic and only momentarily slipping into the normal human range.

The Beast had much the same reaction as she, its ears going back and its muzzle curling in a snarl.

But, the instant the sound ended, the teams were moving.

First, a winged goblin sped past the Beast, nearly causing Marianne to shout in horror as the Beast sprang at it. Horrors flashed before her eyes, but instead the goblin dropped, just before paw connected, and the Beast tumbled into a wall.

And it did tumble into the wall, phasing through the stone and coming to rest upside down, only its face and front paws showing.

As it shook its head, Marianne felt the slow-field shift. Around her medics were moving fast, dashing to each phased goblin. Some goblins went right into bubbles, others needed special fielding to pull them from where they'd been thrown.

But most everyone was alive. It seemed impossible, but the slow field had done its work well. The monk's quick thinking had given the phased a chance at survival, and the work of the medic team was turning that chance into reality.

"King. We have two in solid rock." Echo reported.

He held up a tablet, and suddenly Marianne understood what his voice was for.

On the tablet, quickly being uploaded into AR, was a sonar scan of the area. Each of the phased goblins appeared, including several Marianne had not seen. Beyond the carnage, there was also a map of the tunnels behind the beast, and a tracker working out the best route to navigate through.

Marianne did not ask about the latter, as Bog was calling further orders. The team moved fast, now.

"Only two?” This was from a slim, furred goblin. To an ELF she would have looked like an otter, all lean grace and dark, thoughtful eyes. She, at least, had the proper number of whiskers. They twitched as she stared into AR at the map Echo had made.

“Careful, Autumn.” Bog warned.

She nodded, breathing deep, then turned and dropped to all fours. She bounded across the pavement, whiskers twitching, moving fast through the still-shifting fields, until she reached a point above the dull red pulse on Echo’s map. Then, she dove into the stone.

Marianne’s hand flew to her mouth, covering a gasp. Autumn had not even hesitated. A moment later, she emerged again, a heavy goblin held between her arms, and passed him over to a waiting medic. She shook the fields off her like water droplets, then bounded away again.

“That’s…” Marianne started, eyes wide.

“Very few can do what Autumn can.” Bod said, following his subject’s loping stride with his eyes. “And it is not easy.”

Autumn stopped above the next heartbeat, and dove again. This one was deeper, and there was a tense silence as the goblins waited for her return.

Barely thirty seconds ticked by, but there was a gasp of relief when she surfaced again, two children beneath her arms.

She was coughing as she pushed her way back up and handed the children off.

“Their mother’s still down there!” She called, but it was obvious that even speaking was difficult. She lay, panting, on the street, then forced herself back upward.

“Don’t - “ Bog called, voice full of command, but too late. The otter slipped back into the ground.

“Damn it.” He hissed, striding forward into the slow-field. Thirty seconds ticked by. Then another, and Echo muttered by Marianne’s side, eyes following what only he could sense.

Then she surfaced, gasping, and Bog reached into the ground to tug her upwards, wings buzzing with the effort, sweat slicking his brow, as Autumn writhed and tried to pull free of the stone, the goblin in her arms seeming to cling to the stone. A second later, and they all tumbled backwards.

“There might be - “ Autumn said, but Bog interrupted. “Leave it.” and now she was willing to obey, slumping into his arms until he passed her off to her waiting team.

“That’s all of them!” The fly-medic called.

“Right.” The Bog King hissed, moving to his feet and turning to the Beast. “It’s your turn.”

Chapter Text

“I think you should let it open the bubble.”

Two sets of eyes snapped to Suni’s face, but he had gotten good at standing his ground over the last half day.

“I don’t know what - or who - is in there, but it must be something you want.” Suni said. “Nothing else could scare you so.”

“Excuse me?” Her sneer was familiar, at least. “You dare - “

“You’re scared of giving in. That’s what’s going on, isn’t it? The Imp - no. wait.” The memory of the Imp’s route, irregular as it had been, came back to him. “The Imp was trying to get here, this whole time. Not to whatever was back in that lab. Here. To this bubble. The one in this room.”

He looked up at her, everything finally falling into place.

“What does Roland have on you?”

-----------------------------

Marianne was not certain what she expected when she pictured harrying the Phaser Beast back to its territory, but it was certainly not this.

“Kite! Go!” A winged goblin dashed out of a side tunnel, zipping in front of the beast, such that its eyes followed the new toy. Gyle, the former toy, darted into the side tunnel while the beast was distracted, panting heavily.

Deprived of its old toy, and tempted by the new one flitting in its face, the Beast took off, happy rumble in its chest as it dashed - sometimes quite literally - through the tunnels.

Marianne shivered as she watched Kite flit through a tiny opening, while the cat barreled after him, moving right through the wall as if it was not there.

Admittedly, such a large animal would be terribly constrained, had it not had some ability to make itself better fit into the warren of tunnels surrounding the goblin city, but that did not make watching it move any less disquieting. It slid through walls and floors like glitched AR, senses only focusing on the moving target before it.

“Echo?” Bog called, and a map bloomed in the team’s AR vision. The croak-goblin was moving as fast as possible with his team, mapping the routes for the rest of the group before the Phaser-Beast caught up.

“Nothing stays the same down here.” One of the other goblins had told Marianne. That included the terrane. And with a creature like the Phaser Beast, who could walk through solid stone as easily as it walked on air, the need for map-makers was more important than fighters. The entire endeavor was built around Echo’s skills.

Well, that and the short, playful attention span of a mad beast.

After what Marianne had seen at the tunnel mouth, she would have thought the blood-thirsty goblins eager to harm the creature. Instead they were playing with it, using their fliers and clever mechanical devices to tempt it further away from the city more effectively than violence ever could.

Not that they never hit at it. But those mostly came in the form of loud, unexpected noises or sudden lights designed to push the creature away from directions they did not wish it to go. And it was dangerous indeed to even approach the creature, as the carnage from earlier had shown.

So now Bog and Marianne followed the beast, along with Kite’s team, while other teams positioned themselves along the route, ready to trade off when Kite’s mind or body gave out.

Each flyer lasted roughly fifteen minutes before falling back. They traded out whenever the beast appeared to be getting board as well, switching from shimmering wings to pulsing laser lights to skittering insects whenever the creature started to become interested in something off their planned route.

It wasn’t easy, keeping the Phaser Beast engaged. Apparently, they were lucky it was a juvenile, or else the mission could have taken days, rather than hours, as an adult beast was liable to simply get bored and flop over, or hungry enough to actually try to eat one of its toys. Also, adult Phaser Beasts were even larger. This one was barely older than a kitten, so it was only the size of a house.

“Wall!” One of Echo’s mapping team called out, and the frog-goblin next to Marianne put on a burst of speed while the rest slowed. The Beast barreled on, uncaring of the stone wall that was rapidly approaching, and Kite did his best to continue on as well, barely slowing his speed.

At the last moment, right before the flyer was about to crash into the wall, one of the frogs snapped him into a bubble. The beast barreled on, through the wall, and on the other side the next team had a similar enough looking flyer to keep the beast moving.

Occasionally the “toy” would take the Beast on a roundabout route, zigzagging it through the tunnels, but that was mostly to give the other teams time to set up. As best they could, the Goblins were leading the Phaser Beast on a straight-shot through the underground, getting it back to its territory as fast as possible.

Without Echo and the cartographers, the task would be impossible. Even then, only through some very specific AR codes mapping separate roots for each team was it even feasible to do what they were attempting.

Marianne was completely certain that no Fairy would have the patience to do this. They would have bubbled the beast the instant it started causing problems. They may have even killed it, were someone like Roland in charge.

About two hours into the mission, she asked Bog why they had not done either of those things.

The King snorted. “You think like a fairy. If something is a trouble, just get rid of it. We don’t have that luxury, princess.” He nodded at the beast, who had caught one of the mechanical toys, a bouncing, fuzzy ball, and was rolling back and forth through walls while its hind paws tore at the fur. “Creatures like these are our protection. Try to take an army through a Phaser Beast’s territory, and you’ve got a massacre on your hands. If you don’t know what you’re doing, it’ll pop through any bubbles you trap it in, and weapons phase right through it.”

“So you keep it around because nobody can control it?”

“Exactly. There’s plenty of other things like that all throughout the underground. Goblins know how to stay away from them, and Fairies know to stay away completely. Only someone who knows everything the Underground has to offer could ever threaten the city.”

“Or someone who doesn’t care how many men he loses.”

Bog glanced at her, noting the way her eyes narrowed at the thought.

He was about to say more, when there was a rip, and the mechanical toy came apart, exploding into dozens of gears and parts. The Phaser Beast grumbled, pawing at the mess, then whined unhappily.

That was the cue for the rush to start up again, and Bog’s team was already on it.

“Good Job, Fez!” He called out to the mechanic, who began collecting the pieces of her creation.

Marianne would have thought that the destruction of such a device would have left the goblin devastated, but she just grinned as they flew past. “Lasted a whole minute longer than last time! Go get em, boss!”

He nodded to her, and flew on.

“We’ve found its lair, boss!” Came a response from ahead, filtered through AR. “It’ll have plenty to eat when you get here!”

“Good!” A few more turns, and Bog and Marianne caught up with the next team, who’s flyer was darting in eye-catching spirals, shimmering wings making the beast purr and its tail flick. “Just two more miles to go, everyone!”

-------------------------------------------------------

Suni stood his ground eyes locked on Lady Varanus, and the high fairy found herself unable to lie when caught by the eyes of an ELF.

She turned away, feeling the blow to her pride harder than any sword.

“Nothing. Roland has nothing. He needs nothing to guarantee my loyalty.”

Perhaps if she repeated it enough, it would become true. So she repeated the words she’d said to herself, again and again, and put enough force in them that she, at least, believed.

“I am loyal only to Fairy, as I have always been. I need no bribery to do my job.”

But the ELF still stared at her, brow creased above his idiotic glasses.

“...Those two things aren’t the same.”

“What?”

“Serving Fairy. Serving Roland. Those aren’t the same thing.”

“What does it matter, ELF?”

“It matters…” He paused, but pushed on. “It matters because I can see your history. All that’s unclassified. And there’s never been any doubt that you serve Fairy. From the first time you were passed by on a promotion because someone more flashy could get more support, to every time you let a younger colleague take the first name on the paper, to when you spoke out against unstable fielding against the will of your entire department...you have tried to serve the greater good of your people.

“So, as far as I can see, Roland could only bribe you to go against your history...or just be acting out of cruelty because he can.”

The dark little ELF set his chin and looked up.

“Am I right?”

------------------------------------

The Goblin King and Princess of Fairy took the last leg of the journey for the Phaser Beast. It was obvious why - the three hour trek had left the rest of the team exhausted and the beast growing bored and irritable. Even the boundless energy of a kitten could not hold through the entire underground, and it had been difficult to harry the creature across caverns filled with rushing water and damp foliage. More and more the creature turned its white eyes to any comfortable dry spot, and its claws and teeth were becoming sharper and more violent as they moved on into the larger caves.

Marianne took her stint right before Bog, taking over for a mechanical drone that had lasted a bare five seconds before the Beast had swatted it against a wall in irritation.

She trailed a bubble behind her, reflecting shimmering purple light, twitching on the edge of a string of power. She let it hang behind her as she slowly floated in the only open space of the tunnel, just out of reach of the creature’s claws, memorizing the route before her for when the Beast finally moved.

The rest of the Goblins had many and varied skills, but there was one only she possessed. Patience. As the rest chewed on nails and lashed tails, she floated serenely, the Beast collapsed on the floor before her, panting, whiskers twitching each time she drew the bubble across the tunnel.

Only she was prepared when it finally snapped, roaring as it suddenly leapt at her. Several goblins screamed, but she simply dropped, gravity yanking her out of the way. The Beast’s paw caught the bubble, tearing through the thin membrane like paper, but she had anticipated that as well. As it popped there was a scent of clean, cool air, straight from the surface, and the Beast’s blank eyes went wide at the unfamiliar scent.

They were off a moment later, the jungle-like overgrowth making Marianne dodge and roll, dozens of glowing bubbles pulled behind her, and the Beast fighting for the chance to once again smell the world so different from what it knew.

“Clever girl.” Bog said as he followed behind the pair. The Beast wasn’t the only one who longed for a truly fresh breath deep in the underground. Goblins sighed happily as another bubble burst and the stagnant, recycled air of the Underground was momentarily replaced with cool wind and clean air. It did much to rally his team’s flagging spirits, and they followed Marianne almost as fervently as the Beast.

One, two, three bubbles burst, each one left temptingly floating round a corner, and the Beast followed as easily as a child with breadcrumbs, loping strides eating the distance but for once finding itself an opponent who did not struggle to fly on.

Marianne might think her patience was what set her apart, but to Bog it was her pedigree. Fielding was hard. It meant that flight, even for those goblins gifted with wings, was an exhausting mental struggle. Unhindered, most of them could manage an hour of flight, at most. With the challenges of the chase, fifteen minutes was a stretch. Many of the goblins had finished their stint with wings so clear as to be invisible, their minds too exhausted to summon even the instinctive field.

But Marianne was a true Martian Fairy. Her wings did not disappear even in sleep, and she could juggle both flight and the dozen odd bubbles she dangled behind her without difficulty. Of all the Underground, only Bog himself could challenge her. If their fight before hadn’t proven it, this certainly did. She was laughing as she played with the creature, spinning and darting, using her wings to entice the Beast with strange colors and sounds, even as she sped her way through the Underground with more subtle fields and always managed to just barely slip beneath the Beast’s paws.

Bog had planned on taking over far earlier, but it was such a joy to watch her work that he only joined her at in the last stretch, when he saw her look forward and blanch at the impenetrable wall growing on the other side of a cavern.

She floated down as the Beast sailed over her, confusion written on her face.

“But the map…”

“I’ve got it.” He said. “I’ll take the bubbles.”

“Don’t be silly, you can’t - “ She started, then jerked as he gathered the three remaining strings and easily cut her connection while holding the fields steady. Her eyes widened, shocked at the brazen act, then went even rounder as he danced as easily as she around the cavern, the cat bounding after him, jumping on thin air.

By the end, Bog had backed up almost to the opposite wall and then put on a burst of speed, sending the Beast galloping after him, straight towards the thick wall.

Marianne jerked forward, mind going to the horrible memories of the goblins stuck in the walls back at the city, hand moving in a command, but too, too late.

Bog stopped, a bare inch before the wall, and the cat barreled into him, tumbling head over tail through the solid stone, taking the Goblin King with it.

The scream of warning froze on her lips and she stared in horror at the blank wall, eyes prickling with sudden tears.

“Hey! Fairy Girl! He’s fine.” Echo shouted, and Marianne looked into AR to see the bright red life-sign of the King, and felt her breath return.

She remained silent as they showed her around the long way into the cave home of the Phaser Beast, a long ten minutes where her heart stopped pounding in her throat and her mind caught up with what she had seen.

On the other side of the wall they found the Phaser Beast happily devouring something that looked vaguely cow-like, while the rest of the team, Bog included, looked on.

The other Goblins took one look at the expression on Marianne’s face and wisely moved out of the way, leaving their King defenseless and shocked when she shoved him, hard.

“Was that the plan all along?!” She nearly screamed.

“Ah...yes?”

“You stupid, reckless, IDIOT man - “ She began, finger jabbing into his chest.

“Whoa whoa whoa, tough girl. I have done this before!” He said, hands raised, eyes flickering to the still gorging beast.

It only flicked a single ear in the argument’s direction clearly finding its reward at the end of the hunt far more interesting.

“You mean you’ve dangled yourself in front of a rampaging monster just hoping you wouldn’t end up entombed in flipping rock?!”

“Well…”

“Well?!”

For a moment the great and mighty Bog King cowered before a raging fairy half his height. But he rallied a moment later.

“I am the only flying goblin who could do that safely. I can move through walls. Not easy as Autumn, but it’s not impossible.”

Marianne blinked, distracted enough by the idea that she stopped shouting, and Bog quickly added, “It’s not dissimilar to what we did when we fought. All you have to do is shift completely into the other dimension, and you can move through anything…”

“And then get stuck in walls?”

“Well, yes. That is the danger…”

“So you could have gone through the wall before being attacked by a psychotic beasty?”

“Phaser Beasts are much better at - “

“Nuh-uh, I’m not letting you get out of this. What would your mother say, if she knew you were recklessly endangering yourself?”

“Oh, now you’re bringing my mother into this?”

“Is there anyone else you would listen to?”

“I don’t listen to her!”

“Maybe you should!”

“Uh, boss…”

The two royals ignored Echo as he warbled a warning, both reaching for weapons as they argued...at least until the Phaser Beast growled an unhappy hiss at its meal being interrupted and flicked its tail at them, first sending them stumbling into the other, then with a harder flick sending them both crashing through the cavern, wings tangled and tumbling through the air.

It didn’t even bother Phasing them. The half-dozen spiderwebs, gnat swarm, fungal gel and pollen they crash through before splattering into a mud puddle was more than enough to shut them up.

The watching goblins tried not to laugh, but as the two rulers sputtered, covered in filth from head to toe, limbs so tangled that they could barely stand, they couldn’t help it. Soon, Marianne joined in, and the scowl on Bog’s face lightened until he was chuckling too.

He forced himself to his feet, and extended a hand to Marianne to pull her up as well. Despite his grip, she still clumsily slid on the mud and took a moment to find her feet and pull her wings out of his, but Bog was already turning to the twenty odd remaining members of his team.

“All right, you lot. Good work. But you didn’t hear that from me.” They were now all far enough away from the Beast that there was no danger from the cheers. “Observation team, you keep an eye on our friend here, and make sure it gets fed anytime it looks like its tempted to stray too close to the city. For the rest, off with you!”

There was another cheer, and general back-patting for a job well done. A team Marianne hadn’t seen yet was removed from the bubbles, along with equipment they set up around the cavern, while most of the rest lined up again for Bog to bubble them, then set off with their team leads back to the city.

As this was all happening, and as the Phaser Beast curled up for a nice long nap, Bog leaned down to Marianne.

“There are baths back at the Castle.”

Her grin split cracks into the mud on her face. “You know just what to say to a girl, don’t you?”

Beneath his own mud, Bog grinned back, and was privately grateful his own mud covered his blush.

-----------------------------------------------------------------------

“...fine. Undo the bubble, for all I care. It’ll be on your head when Roland finds out.”

Lady Varanus looked away when Suni nodded to the Imp. The creature had been tapping its claws as they’d spoke, looking incredibly bored at the ELF and Fairy argument, but perked up at Suni’s gesture.

It jumped to its feet and performed an elaborate salute, then uncorked the bottle.

A voice spoke in AR, repeating the instructions Suni had heard only once before. Every rule was familiar, but the last, and he felt a stab of guilt as the droning voice added -

And be sure to coat the entire bubble entirely. One can always re-create a completed field, but it is near-impossible to patch one that is damaged. It is easier to print a picture than un-jumble a jigsaw, after all. Never expose the potion to unbubbled fairy wings…

His shame nearly prevented him from watching the Imp douse the bubble, but the creature made a show of it, looking for all the world like a bar-tender unveiling a special concoction, finishing with a flourish that left the bubble hanging, mid-air, as the film lightened, stretched, then, finally, popped.

Suni wasn’t sure what he’d expected. A monster. A computer. Something impossible. Instead…

“Pare?”

Chapter Text

Every ELF on Mars knew Pare Sunderman. Not knew of him. Knew him.

He was one of the few people in all of Mars who had published his journals, way back when the monarchy was first established and everyone was testing out the strange new powers that came with being a citizen of Mars.

He had been a simple man, working in a tiny country in Europe, when the Crystals had struck and the Earth fell. When he had been Awoken, after the worst of the early years of colony building, and at the beginning of what would be considered the Golden Age of Mars, he had been brought back to act as Steward to the Castle, for his small country had been a monarchy, and his father had been valet to the King. In the beginning, Pare had thought his Awakening had been a mistake, for he was a slow, thoughtful man who had tended to the Royal Stables, rather than the Royalty themselves.

In his journals he had chronicled his worry and concern, his feelings of inadequacy and awe at the fantastical beings he had been brought back to serve. But through it all he worked hard and slowly grew to love his new home. Now every stone in the Castle bore his mark, and every Martian of the Light, Fairy or ELF, looked to him as the perfect embodiment of an ELF.

Those journals he had written with a slow but steady hand had been a comfort and inspiration to most every ELF that had been Awoken since his time, a thousand years ago. He taught them how to be good servants, wise friends, and staunch supporters of the Martian Government.

Secretly, the tiny rebellious streak that Suni tried so desperately to hide wondered if the man had actually existed, or if his journal had been edited such that anything unpalatable was stricken from the record.

But now the man was in front of him, exactly how he’d appeared in the pictures from the book: broad shoulders, durable, unadorned clothing, wide features, thick hands with nicks and calluses that could not be faked.

He blinked, clearly disoriented, and Suni hurried forward to catch him before he stumbled.

“Thanks, lad.” The hand that fell on Suni’s shoulder felt like a sack of bricks. The man was nothing but muscle, for all that he looked soft at first glance. “Fairy bastard must of got behind me, eh?”

“Um…”

“That or I had a bit more that ‘a bit too many’ an’ forgot me wings!” He laughed, a deep, rich boom, and clapped Suni on the back. “So. What need’s fixin?”

“That’s not…”

“The world.”

Pare froze at Lady Varanus’s words, his friendly smile dropping instantly, head snapping to stony Fairy.

Suni quickly spoke up. “That’s just Lady Varanus. She’s not - “

“Lizzie?!”

-------------------------------------------------------

Marianne nearly squealed when she saw the baths. Like most Martians, she had been raised on frugality when it came to water. Baths were something for babies, quickly switched over to sponge-baths or, if in a truly disgusting situation, a full shower with recirculating water.

There wasn’t really any reason for it, anymore. While Mars would always be an arid planet, and no Martian had ever seen a rainstorm, there was now enough water that rationing was not needed, except when it came to water-intensive industries like agriculture.

Eight centuries of intensive bio-engineering had resulted in all kinds of strange plants that operated on as little water as possible, some forgoing it entirely in favor of other kinds of liquids or nutrients. Similarly, every mechanical system on Mars was remarkably efficient when it came to water, capturing every drop. The forests and grasslands that surrounded the populated areas of Mars wicked up every hint of moisture before it reached the less carefully maintained dead-lands like the Mushroom Cities and the areas around the Crystal. Every drop of water was collected and recycled over and over again, only being removed from circulation if it was irrevocably poisoned or irradiated. It was this system that gave rise to the giant tunnels beneath the Martian Castle, hundreds of years of different ideas for cleansing all tied together and stretched like a lifeline across the planet, efficient even when abandoned.

Given how long the Goblins had been cut off from the rest of Mars, and the fervor with which ELFs and Fairies alike protected their water rights, stars only knew what the water the Goblins used originally came from. Certainly nothing that a normal Martian would consider drinking.

But, even though it was childish, even though she did not want to know the source of the water, Marianne dashed forward the instant Bog showed her to the Castle’s private baths. They were deep beneath the structure of the huge trunk, nestled beneath what would have been a maze of roots, had the whole structure not already been underground.

If he had called ahead to have the area cleared, she didn’t know, but the baths were empty when they entered. Behind the locked door, hidden away from just about everything else in the city, was a room with nothing but five wide, shallow pools. Steam (another thing that was quickly captured in above ground settlements) hung in clouds above the baths, and the air smelled lightly of metal, but not overwhelmingly so.

She ran forward, dropping her clothing as she went, and Bog coughed.

“Ah. I’ll, uh, leave you to it, then…” He hurried backward, trying to look anywhere but her naked form.

“What? You’re just as dirty as I am!”

He stuttered, feeling his face flush to the tips of his ears. “Ah - well, I wouldn’t want to - “

She quirked her head to the side. “What are you talking about?”

He risked a glance up, and found her form hidden behind a shade from knees to chin, the field she’d wrapped around herself distorting her body into featureless pink.

She laughed at his expression. “I take it not many goblins can use fields as bath-towels?”

He scratched the back of his neck. “No. Most goblin fields are a bit more...specialized.” It was a clever idea, though if he were honest, most goblins had no need of it. With forms so different from the human norm, and great variety within the species, there wasn’t enough similarity to have a unified idea of modesty. Those who felt they needed it - or simply enjoyed wearing things - wore clothes, and didn’t bother those who found no need for them.

He explained this as he eased into the water after her, sighing happily as the warmth began to seep into his aches and bruises.

The water clouded for a moment as the mud washed off, but quickly cleared again as the particles present in the water filtered out anything not attached to the two bathers, each algae piece swelling up and dropping to a collection plate at the base of the bath when it had finished its work. A whistle from Bog summoned some sponges to the side of the bath, the little creatures chittering happily at the scope of the work they would be asked to perform.

Marianne tickled hers into a thick lather while comparing the goblins’ laissez-faire attitude towards nudity to the fashion-obsessed ELFs and Fairies of the upper world.

“I heard Belters were more sensible.” Bog said as he scrubbed his sponge hard against his armor, much to the little creature’s delight.

Marianne did the same, her skin easily returning to its pale color. Bog was almost envious - no one would be able to tell the difference between his mud-splattered armor and its regular mud coloring.

“Yet Fairies who’ve never been off world look down their noses at Belters for being a season out of fashion when they get back.”

“Have you?” He clarified, “Been off world, I mean.”

She shrugged. “Royals are expected to do a tour of the satellites when we come of age. But I’d never be allowed all the way out to the Belt, or even to the gas mines on Venus. Too ‘dangerous’ for a Princess.” She rolled her eyes and gave a particularly vicious scrub.

“Yet here you are, having a bath with your worst enemy.”

“Hah. You might be scary, but at least you’re honest. I’d much rather be here than back at the Solstice Ball.”

“Now I’m insulted. I worked hard to be that terrifying.”

She laughed. “Says the guy too embarrassed to take his armor off in front of a girl.”

She knew she’d said something wrong the moment the words left her lips. She’d meant to tease him, falling into the comfortable companionship from years spent with Suni washing her back.

Instead, at her words he froze, easy grin falling from his face, eyes widening it what she could have misinterpreted as fear, had she not known for a fact that he was easily her equal in combat.

She didn’t notice the way his hands clenched, claws cutting into his hands and seeping blood into the water. But she apologized anyway.

“Sorry! I shouldn’t have -”

“It’s alright.” The way he hissed the words showed it to be anything but. “It was a natural question. And...perhaps it will help you understand. Just...don’t say I didn’t warn you.”

Then he began to remove his armor, and Marianne felt true horror bloom in her gut.

------------------------------------------------------

Two hours ago, had Suni been told he would see Lady Varanus crying, he would have laughed the teller out of the room.

Now he was trying to scrape his jaw off the floor.

The stony, impenetrable facade of the Fairy woman had crumbled, lasting for only the two steps it took Pare to get to her. She tried to fight it, all haughty glare and sneers, but her lip wobbled as he approached, and now she was wrapped in his arms, sobbing her heart out while the big ELF ran his large hands through her thin hair.

“I’m sorry, love.” He said, and her wings wrapped around him tighter as she shook her head.

“Its my fault. shouldn’t have - “

“Don’t let tha’ bastards words get to you.” While his earlier mention of ‘fairy bastard’ had been light and teasing, now the word was spoken with barely dampened anger.

She shook her head again, and leaned against him, her tears so strong she was shivering with them.

Pare let her cry, before gently asking, “How long?”

She sniffled. “Five centuries.”

“Oh, Lizzie.” He tightened his hold. “Why didn’t you bubble yourself?”

“He said - “

“And you listened? You know e’s a lying bastard.”

“But you were here. All along. Just like he said…”

“You should ‘ave left me behind. Lived your life. Found someone better for you.”

She shook her head, and pulled herself away far enough to look into his eyes.

“No. Never. I couldn’t. Not just for me. Your their hero too.”

He barked a sad laugh. “Some hero.” His frown grew, and he ran a thumb along her jaw, wiping tears away, calluses catching on smooth scales. “What did he do to you, Liz?”

She looked away. “Nothing I didn’t deserve. He -”

Whatever she was about to say was interrupted by a pounding on the door, and all three flinched at the voice of Fairy guards.

“Open up! Trespassers into General Roland’s chambers will be dealt with lethal force.”

Lady Varanus - Lizzie - jerked out of Pare’s arms, AR shield going up and hiding her tear-stained face with her normal cool facade. She waved a hand, and the door slammed open.

Two guards, armed with weapons that looked just as lethal as they had threatened, burst through the door, only to find Varanus standing completely at ease before them.

“Gentlemen. As you can see, I have every clearance to be here.” She said, glaring them down.

The two stumbled to a halt, clearly not the best or the brightest of the guards left to the tower, despite the gold wings on their backs.

“Uh, Lady Varanus. We received a warning that - “

“Obviously a false alarm. We are here on government business.”

“Oh. That’s…” The bigger guard squinted, reading Varanus’s aura, completely unable to find anything amiss.

Suni breathed a sigh of relief. The guards had not even glanced at him and Pare, ignoring them as easily as all the other furniture in Roland’s room.

“She’s lying!” A croanish voice barked out, and Suni spun to find a wizened ELF woman clutching a squirming Imp. “She’s letting a criminal get away!” And she pointed straight to Pare.

Instantly, the guard’s eyes widened. Glancing through his glasses, Suni saw what he hadn’t before. The old woman’s words were true. Pare’s aura flashed blood red, screaming to the world that this man could not be allowed to ever leave Roland’s space.

It didn’t matter that such a thing made no sense. It didn’t matter that if they just looked, they would have recognized the man for who he was. The guards launched themselves at him, shoving Varanus away and powering up their weapons.

Before, they hadn’t even glanced at him. Now, they didn’t pause for a moment to look at anything but the aura, blind to even his name.

Suni was shoved aside as well, slamming to the ground hard enough to shatter his glasses. Lady Varanus screamed, and laser lights blasted, scorching Suni as he fell. Through blurred eyes Suni saw Pare dodge, agile despite his size, smoothly evading but with nowhere to run.

Apparently the guards had not expected to fall over another ELF - or not noticed Suni at all - and they were slow to react, stumbling into each other as they advanced on a still-living enemy, confused at the sound of shattered glass and nervous of a weapon. But it didn’t matter. There was nowhere for Pare to escape to. The guards were between him and the door, and even if he could get out, the whole tower defense would be alerted and he would be killed in moments. The only reason he was still alive was because he had not set foot outside Roland’s room. But that would not last.

Suni swore, looking straight into death as the first guard reset his weapon. He would shoot right through Suni, if it meant getting to Pare…

No. The code came to his hands. He couldn’t see it, but that didn’t mean it wasn’t there. Even as he watched the trigger pull, the words were in his mind and at his fingers, and he forced them into being.

The other guard shoved the gun away, and the shot went wild, destroying another painting.

Suni stood, panting, in front of Pare. He held one hand up, blank to his eyes, but both guard’s fixated on it.

“Exception.” He said, picturing the red box in his mind. “The criminal Pare is to be transported with Lady Varanus and the Potion back to General Roland. Override 4678.” He prayed that Marianne’s command still held true, and every ‘servant’ still belonged to the royal house. “Command effective immediately. Stand down. I repeat. Stand down.”

Tension evaporated, and the guards snapped to attention.

“Our apologies for the confusion, General. We will arrange for transportation immediately!”

The guards bowed, eyes focused three feet above Suni’s head, and then hurried out of the room.

The little ELF sagged with relief.

Varanus and Pare shared a look.

“How...how did you do that?” Pare finally asked.

“Well…” He scratched the back of his neck. “That depends. What do you think I did?”

-------------------------------------------------------------

There was a reason Bog rarely removed his armor. He slept, ate, and bathed in it, living as if it was just another skin, which to a certain extent it was. It had been months since he’d removed it all, years since he’d allowed anyone else to see him when it happened.

It wasn’t that he trusted this strange Fairy Princess. But he did find himself caring about her and her mad sister. And he knew better than to let that last. Better to rip the bandage off and show her what he truly was, and let the screams remind him why no one could be trusted with his true self.

He could almost feel the temperature drop as he pulled each bit of armor off, and it bit into the pleasure of freedom to know what it cost. Of all those who had seen him like this, she was the only one since his escape that knew what his form meant. The others, goblins and ELFs alike, simply saw him as a monster. Only a Fairy could understand the horror.

He set the last piece down on the side of the bath, and out of cowardice watched as the sponges happily converged on the pile, unwilling to look and see disgust on such a pretty face.

But he was King. He had faced worse than a sickened fairy before.

So he turned, still not meeting her eyes, and flexed his wings.

“Well? Horrified yet, princess?”

He flinched from the reflection in the water. With the armor, he looked like a twisted fairy, all their darkness come back to haunt them. Without it…

He was covered in wings. Little half-formed fields ringed his form, some barely emerged from the skin, others rising a few hands away, but placed such that they screamed wrong. No pretty armor, no sensible robes, they were undoubtedly wings. Some looked almost fairy-like, others refracted light like his regular insect-like wings, most were barely visible beyond ridges and ruffles matching each plate of his armor. All were undoubtedly twisted from what they should be.

The reflection didn’t lie. He was a monster. A freak. Something no one could love, that most could barely stand to look at, that sent even his mother screaming…

But, when he finally forced his eyes upward, he heard no scream from Marianne’s lips. And while there was horror in her eyes, it was washed over by another emotion, one that dripped from her lips when she finally spoke, teeth clenched and voice shaking, fury coloring her wings an almost pitch-black purple.

“Who did this to you?”

Chapter Text

Back in the Tower, Lady Varanus retold the strange scene from her perspective as she wrestled the Imp back out of the old ELF woman’s hands and sent her packing, ignoring the old woman’s mad laughter.

“It looked like you received a message from the General, with orders and an override to allow Pare to leave the building. Your clearances showed you to be an official messenger, and there was a recording from Roland to back it up. The override hit Pare’s system while they watched.”

Pare shook his head. “It looked just like Roland, too. How’d you manage that?”

Suni shrugged. “He lies all the time with AR. I thought maybe I could do the same.” He glanced between the two. “Was that...wrong?”

“You saved Pare’s life. And prevented innocent men from becoming murderers. I believe that counts as the ‘greater good’.”

Pare chuckled at Varanus’s words, sharing some kind of private joke.

“But everything you did...it was true.” Varanus added, still impressed.

“Not really." Suni shrugged. "The override was real, but it wasn’t from Roland. Princess Marianne declared that any servant harmed by Roland could be seized by the Royal House. So I just had to make Pare a servant, and then force the override.”

“But the video - that looked exactly like him!” Pare said, shivering slightly.

“Royals use AR for messages all the time, and I write a lot of Princess Dawn’s correspondences. If they had looked closer they might have noticed it was just a model, but its it's common enough for these kinds of messages. It was easy enough to grab the model off his virtual desk. Takes care of voice too. Everything - the way the protocol looked and all that - was just effects to make it look right.”

Pare whistled. “You lost me. That just seems magic to me.”

“Especially given that you did it blind.” Lady Varanus’s eye-brows were high on her forehead as she examined Suni’s shattered glasses. “Your commands would have needed to work flawlessly.”

He shrugged. “It’s what I do. I’m sorry I couldn’t think of a better way out.”

The Imp chittered from Lady Varanu’s shoulder. She sighed. “It has a point. We promised we would do exactly as you said.” Then a thoughtful expression crossed her face. “In fact...this could work to our advantage.”

“How so?” Pare asked, only for Suni to interrupt “Oh! I see!”

“Huh?”

“Roland has you classified as a criminal. But you’re a hero, too. There’s plenty of ELF soldiers who remember you, and they would be glad to have you on our side. He could never bubble you with them around.”

The Imp chittered its agreement.

“Huh. Back to being a symbol again.” The ELF hero said, a bit ruefully. “You won’t hear me complaining, if it keeps me near Liz.”

He smiled, and Varanus flushed, and Suni wondered if Dawn would look that happy whenever she finally fell in love.

-------------------------------------------------------------------------------

A few hours later, things began to settle. Lady Varanus had sent word to an army attache, and they had been met at the bottom of the tower by a waiting transport.

The vehicle had bucked out of its handler’s control at the sight of them, squealing tires in its haste, and for a moment Suni worried that the kill-order still held. But the vehicle didn’t mow them down, screeching to a halt just in front of Pare and tooting playfully. In response, Pare laughed and crouched to scratch just below the right wheel well, making the vehicle rumble playfully and butt against the ELFs thigh with great affection.

If there was any worry that Pare might still be harmed by the soldiers, it evaporated right there, as ELF and Fairy alike beamed at the treatment of the vehicle. Then, as Pare stood and ran a hand over the creature’s flank, inspecting it with a practiced eye, there was a ripple, as suddenly the soldiers began to recognize him. Whispers started, in equal amount to stunned silence and rapidly blinking eyes - the latter coming from soldiers turning their AR on and off to confirm that yes, the Pare Sunderman was standing before them.

“You...you’ve come back?” A young soldier asked, wings flickering and wonder in his eyes, only to be elbowed by his ELF sergeant.

“O’course ‘es come back! Mars is in crisis! That’s when heroes always come back!”

Another, more experienced, soldier whispered to the attache, “Roland’s really pulling out all the stops on this one, ain’t he?”

The Attache’s eyes narrowed, even as his wings stayed rock steady, glancing from Pare to Varanus, and then even noting Suni.

“Yes...it appears he is.”

But whatever he thought of Roland’s apparent decision, he did not voice it, and they were all loaded onto the rover. Pare, of course, was given a seat at the front, near the driver, and soon they were in deep conversation, Pare asking dozens of questions as he looked over the driver’s maps, a bevy of soldiers all eager to help him update his knowledge of the new Martian terrain.

Suni was barely noticed, shoved into the back, not even accorded a seat, placed next to Lady Varanus as she sat at the command center. The Attache, Riesling, immediately returned to AR, while the sergeant Darius called orders to the troops and oversaw their return to the wider convoy.

Suni tucked himself into a corner, trying to make himself as unnoticed as possible, at watched the ten-man team operate, keeping a close eye on Pare, even as the man was immediately welcomed into the group.

“That’s why he was bubbled.”

Suni glanced up, finding Lady Varanus’s eyes locked on Pare as well. A quick glance confirmed that no one else had heard her words - even if Suni’s glasses had broken completely, her AR still protected their private conversations.

“...what do you mean?”

“Just look at him. He really is the Hero of Mars. An ELF that even Fairies respect. And to men like Roland...that makes him a threat.”

“I don’t understand.”

She shot him a withering look, back to the frigid and dangerous Fairy Scientist he had met earlier in the day, not a hint of the woman that had melted in Pare’s arms.

Suni looked back to Pare, the easy smile on his face, the thoughtful way he listened to the words of those around him, the careful questions that demonstrated a practical kind of intelligence unmarred by the arrogance his position should have brought. He bowed to the fairies, smiled at the ELFs, and treated all the various companion creatures around him with respect.

It was strange to think that this man was a threat. He acted exactly as an ELF should, albeit one with the kind of expertise that made him indispensable. He was...perfect, in a way that Suni instantly envied. His whole life, the little ELF had chased Pare’s ghost, never quite as comfortable bowing, never so easily subservient, always a bit too smart to be accepted by Fairy.

And perhaps that was what made Pare dangerous. People liked him. He had no airs, no desires above his station, yet his legend was such that Fairies and ELFs alike could associate with him without harming their status. And if Fairies could come to respect and ELF just as much as one of their noble peers…

Then the whole easy division of Martian society could be challenged.

Lady Varanus noticed when Suni’s eyes widened, and nodded, adding,

“It used to be, every few decades there was a reason for him to be called out. His knowledge of the forgotten systems of Mars might only be matched by the goblins. He’s fought rogue animals, outbreaks of disease, and prevented the Castle from crumbling dozens of times. Not necessarily because he himself has the knowledge to fix the situation, but because he always knows exactly who would.

“That’s how we met. As a young woman, my town was attacked by a rogue disease that sent genetically modified creatures mad. Pare was brought back to corral the beasts and find survivors. The team he assembled were able to track the fault to something that incubated in bubble-space, and they were able to stop the outbreak before it endangered the rest of Mars.”

She smiled, a bit sadly. “I was so proud when my expertise on bubbles helped the great Pare crack the mystery. That someone so famous, so important would notice me seemed impossible. But Pare notices everyone, even a Fairy girl from a town so provincial as to not even have a name.

“And he remembered. I was shocked when, fifty years later, he called me up to help with a new outbreak. We met regularly after that. Every ten years or so, there would be a reason for him to come back, and he would reach out if he thought I could help. Somehow that turned to him calling me every time he came back, just to catch up. And then...well. He remembered a time when Fairies were rare. When you couldn’t look at someone and tell if they were from Mars or Earth, and no one cared if a Fairy and ELF married.

“But it wasn’t like that anymore. A Fairy and ELF being together was dangerous. We didn’t hide our relationship, but with my work and his spending so much time bubbled, no one noticed.”

“Except for Roland?” Suni asked, beginning to see where the story was going.

This time the smile was rueful. “No girl wants to be told that their relationship endangers the very fabric of Martian society. But this was Roland. He was very convincing. And he was so very worried for me. He knew just how terrible Fairy society could be. If my relationship got out, more than my life would be ruined. My work. My reputation. My team. My family. Everything was in danger, just because I was fool enough to fall for someone I shouldn’t have.

“Looking back, I was a fool for having listened, and not looked a little harder. As it was, Roland bubbled Pare “for our own good”, and no one noticed until they needed him for something and the bubble wasn’t there.

“It was a minor crisis, comparatively, so the Upper Council kept it quiet, and a team was able to find a solution on their own. The High Council decided that perhaps Fairy had become a bit too dependent on some random ELF, especially one that could do as he pleased and the populace would still adore him. There was never any search for him. Never any investigation. And just like that, he became a story, not a man.”

She paused, staring at the strong back of her lover, hands clenching on her dress.

“I never thought I would see him again. And all this time...I thought Roland was right. What we were doing was wrong. Was dangerous. That things were better now, that the ways of the past were gone for a reason, and that my happiness could never out-way that of all of Mars.”

“But Roland was wrong.” Suni said. “And what ever he made to you do to ensure Pare’s safety - it must have been wrong as well, or he wouldn’t have needed to force your hand.”

Varanus’s lips tightened, and she looked away. But Suni didn’t let it go.

“What is in that room, Lizzy? What did he do?”

-----------------------------

Chapter Text

As Bog had removed his armor, Marianne had found herself unable to look away, even as the realization of what was before her sank in, curling in her stomach and souring what had been a pleasant conversation.

She had been terrified when she had first seen him, standing in that dark corridor, all sharp points and ice cold eyes. His form had haunted her dreams the night after, impossible to forget, each broken spike and scratched plate branded into her mind.

Cold eyes. Rough skin. Twisted wings.

Caught in dreams, she had not been able to escape. But worse than the horror, than the natural fear, was what she had felt when the shock had worn off.

Fascination.

What would he have felt like? Some hidden part of her asked, sneering at the instinct that made her flinch away. Was his skin like bark, or chitten? Was it naturally smooth, or would it scrape against her fingers? Did he have claws, or talons? What could his wings do?

What would they feel like?

What would he feel like?

It wasn’t terror that had woken her that first night. No. That would have been too easy. It was the heat that had woken her. Her mind had rebelled against what her body whispered, tearing her from slumber as she had wondered what his lips would have felt like against hers, if he would have felt hot or cold had he pressed against her, what colors she would have seen had his wings touched hers, how his neck would have felt against her tongue…

Terror was damnably close to arousal, after all.

Fury was an easy refuge against her traitorous body, and she had thrown herself into it hard, but the more time she spent with him, the more comfortable she became with the odd forms of the other goblins, the less fear she felt, and the more curiosity and desire won out.

And now…

Now she was being shown something none of the others had seen, because she alone could understand what he was revealing.

No goblin would understand. No ELF would see. But any fear she might have had was drowned out by the knowledge of what must have been done to him for this to be the result.

She had grown her wings at age five, the youngest in her family for generations. Her wings were stronger than any but her mothers’, and the pain had been equal to it. The servants had barely been able to get her into the ceremonial bubble before the madness had taken her, and she had spent five earth years locked away from the world while her mind opened and her wings unfurled.

Until that moment, she had believed that her experience was not something that could have been changed, or forced.

But now, even the traitorous desire could not speak over her rage.

Bog’s wings were not natural. No human mind would want something like what he displayed. And ELFs and Goblins might see the wrongness, and recoil from it all, but only a Fairy could understand the further truth.

Wings were displays of the soul. The mind itself. The impossible abilities gifted by interactions with bubble-space, interpreted into something the human mind could understand, reflected in turn the creature doing the understanding.

Damaging a wing meant damaging the mind behind it. Breaking a mind meant breaking its wings.

To make what she saw before her now, would mean breaking a child’s mind, over and over, until the scars would never heal, and the mind would never recover.

This was not natural.

Someone had done this to him.

And they would pay.

Chapter Text

“I don’t blame them.”

Bog’s words spoke over Marianne's rage, splashing freezing water over the furnace of her anger.

“What?”

“I don’t blame them.” He said again. “It wasn’t their fault. They didn’t know what they were doing.”

“How the hell - “

“...I should start from the beginning.”

-------------------------------------------

Lady Varanus sighed as she began her story, but Suni could sense a certain amount of relief from her tight features. Whatever she had been concealing, it had weighed on her for years, and finally being able to share her story relieved that weight, even if it was just a nobody ELF who would hear.

“The facility we were in is one of the oldest research institutions on Mars. Originally, it was placed there to be the furthest from both the majority of the Martin population and the furthest from the anti-technology field exuded by the Crystal.

"It existed long before the Castle. But the castle could not exist without the technology created by the institute."

"....it’s the original government research facility, isn't it?" Suni asked, beginning to understand.

"Not the first. But the one that housed all the most dangerous, classified, or ethically questionable research.” She answered, before continuing.

"It was first used to study non-bubble fields, back at the very start of Martin colonization. But after that, its scientists pioneered the study of bio-engineering, wings, and AR tech.

"When the government of Mars moved East, it made sense to build the castle there, because the shield generators and invisibility fields were already in place and the first space elevator was being constructed right above."

Lady Varanus rested her chin on her hand, looking out across the wide fields, back towards where they'd come. The thin line of the elevator could be barely seen, twenty miles behind them, but the whole castle anchored it to the ground, the structure huge even before the castle proper had been made.

"Most of the research that took place there has since been declassified. No need to hide the origins of something we use every day, after all. But there are certain things that have been...sanitized. And other things that have been struck from the record completely."

"...like whatever happened in that closed off room?"

"Exactly" She turned to him. "There are three major projects that have been censored from all record. All three had their start in those rooms. And all three had one person in common."

-----------------------------------------------------------

“Ugh. I hate this.” Dawn shifted, tugging at her wings, unable to pull them from the healing bubble.

“It just takes time to heal, deary.” Griselda said, patting her leg, one eye kept on the monitors and another on her charge. The girl had been recovering well, partially because of Bog’s quick work getting rid of the potion, partially because they had kept her sedated and her mind had accepted the drugs quickly.

She was beginning to build up a resistance. Which slowed the healing, but also meant that she wasn’t singing so much. The other goblin doctors all thought this was a very good thing.

“But Grissy. My Boggy-Bear is out there with my sister. She’s going to win again.”

Griselda blinked. While it was lovely to tease Bog about finally having an admirer, the idea that he might have two, one of which was not higher than a kite, was both wonderful and a bit worrying. He had not fared well in any of his relations with fairies. Perhaps it was no surprise that these two were bringing an army down on his head, given his history.

“What do you mean, win again?”

Dawn sniffed. “She gets everything important. The crown. The respect.” And, before Griselda could re-evaluate the sense in the girl, she added, “And she got Roland.”

The Goblin woman flinched. “You dodged a bullet there, love.”

“Nuh-uh. Roland is perfect. He’s so pretty. And smart. And everyone likes him. But he only ever cared about her.”

Griselda forced herself to release her hold on the syringe before the fragile crystal cracked.

“I suppose it would have seemed like that to an outsider.”

But Dawn babbled on, not hearing her words.

“But Mari gave him up, and she won’t tell anyone why, so now everyone hates her, and Roland only ever talks to me when he needs my help to bother her. We’ve known him all our lives, but he acts like I’m stupid and silly. I’m just as much of a Princess as her! But she has to take all the best boys! Why couldn’t she leave Boggy for me? I could save all of Mars by marrying him! Why does she get to be the hero again? Am I not good enough for anyone? Even a goblin? What’s wrong with me?”

Thick tears rolled down her face, and her lip wobbled.

She’s just a child. Griselda told herself, sternly, trying not to blame the girl for words which bubbled out under drugs. They had the feel of things Dawn herself had repressed, tamping her envy under layers of guilt until she would never think of it in her sister’s presence.

She was a victim, just as much as the rest of them.

With that thought in her mind, Griselda turned and faked a bright smile.

“Why don’t I tell you a story? It’s about my Boggy when he was just a wee boy.”

“About baby Boggy!” Instantly Dawn’s face split into a grin, her earlier tears forgotten.

“Aye. About a baby Bog, and the evil man who stole him away…”

Chapter Text

"The project I worked on was a derivative of Field Research." Lady Varanus began. "Its goal was to understand Wings."

“Sometime in the 400s, people began developing Wings. Scientists, mostly. Or Merchants. People who worked the most heavily with bubbles.

"At the time, no one really thought anything about it, because they were busy doing all kinds of other gene mod. A person being able to float a bit, or reach out and grab something with their mind, didn’t really register compared to spacers who breathed methane or full cyborgs or the fully ‘upgraded’ Martians who could survive everywhere from the surface of Mars to outer space without a suit.

"It wasn’t until the 700s that people suddenly realized that these wings some people had were strange. Not physical. Not wholly mental, either. And not some weird artifact of the new over-net, which was the assumption for a good two hundred years.

"And about the time that people began noticing that Wings were Different, they also began realizing that they seemed uniquely Martian. Oh, anyone could come out of a bubble with wispy, near-useless wings, which was one of the reasons they had gone unnoticed for so long. But anyone who could fly was from a family that was near pure-bred Martian. It took another hundred years or so before they realized that it wasn’t an artifact of the gene-mod, either.

"By the 900s, it was possible to tell ELF from Martian by wings alone, so many people had them. And people realized that they were something worth studying. Don’t think it was out of altruism, or genuine scientific curiosity. The Martin government found Wings an easy way to separate the true Martins from the ELFs. Laws went into place, before any real understanding of the origin of the mutation, separating those with wings and those without, and codifying all real power into the hands of these new 'Fairies'.

"Suddenly there was a reason to prevent ELFs from getting wings, and a large incentive for understanding the extra powers that the upper-classes had suddenly found themselves access to.

“The Wing Research Division was a logical step. It was publicly part of the 'normal' government research department, nestled under the umbrella of the Field Research Division and thought of as a bit of an oddity. Of course, the actual work was highly classified, drawing in the best scientists from across the planet, who were given the best tools influence could buy.

“I joined Field Research in 1127, inspired by Pare. I was young, naive, and oblivious to the office politics around me. The public-facing arm of the Division was packed with well-connected royals who did very little work and took most of the credit from their ELF subordinates and Fairy students. I spend a hundred years playing nice and only complaining to Pare when it got too much. Anyone with morals went to work at the Repository, and anyone with sense transferred into a different field. Those who lacked either, but had the scientific skills to do horrors, somehow 'disappeared' from the public eye.

“Looking back, I suppose I was the later, because I stuck it out, honestly believing that I was doing good. I even dreamed of finding a way to give ELFs wings, so Pare and I could be together, even after the Ban went up and ELFs and Fairies were officially barred from marrying.

“And, after it all, when the General came to me and requested I work on a special task force to investigate the creation of wings, I thought perhaps I was finally being rewarded, even if it did come with a threat to harm my lover.”

“Wait. Roland was the director of a science lab?”

“Oh no. He was in charge of all the classified research. And his signature project just happened to be the most highly classified in Mars. He studied the goblins.”

-------------------------------------------------------------

“It wasn’t their fault.” Bog repeated.

“Really.” Marianne said, arms crossing over her chest, which Bog belatedly realized was uncovered. Her anger had cost her focus, and everything but the fields connected most strongly to her emotions had fallen away.

Then again, he was showing something far more private than a bit of skin, so perhaps it was fair.

“Here. Let me show you.”

He summoned a file in AR, and threw it over. Her system caught it, even though she herself did not move.

“This is…?”

“My origin file. Born 2025, New York, 6 years old...the important bit is the classification.”

Marianne’s eyes didn’t even flicker as she read. She simply sputtered.

“Canine?!”

Bog smiled, though admittedly it looked a tad more like a grimace. “Aye. My cousin was the one loading us all on. It was a joke on my family name. Little “Rexy” he called me. ‘Mah favorite pup’. “

He paused, the memory of the day forever branded in his mind. Screams, chaos, the terror. Pushing, shoving, near riots at the bubbling centers. And Cousin Ronin, ruffling his hair and promising they’d all be together again at the other end.

“...It was a bad joke. But I survived, and he didn’t, so who’s to say who had the last laugh?”

Marianne looked up sharply, eyes narrowed, but it was obvious she had heard such gallows humor before. Odd, given that only Awakened ELFs usually spoke that way, and rarely around their Fairy masters.

“...anyways. Sometime in the, oh, 700s, the Martian government decided to start investigating wings. They knew that ELFs rarely gained wings, but quickly realized that Goblins often had wings, or at least something similar. They had just learned how to identify Goblin bubbles, so they set about looking for Goblins that would be “safe” to experiment on.”

Marianne looked blank for a moment, then said “...animals. They were looking for Goblin animals. But...I’ve never heard of a ‘goblin’ animal.”

“Probably because there aren’t any.”

“Eh?!”

“Just like there aren’t really any goblins.”

“What?!”

“Let me explain.” With a flick, Bog drew up a chart in AR. “Think of how Mars is divided, ignoring goblins. Now, you have “Fairies” and “ELFs”.” Helpful figures, one with wings, one without, appeared on the chart.

“...right.”

“And ELFs are supposed to be “Earth-origin Life Forms”.”

“...right.”

“But there are plenty of ELFs that were not born on Earth.”

Marianne blinked. Technically, he was right. Since Fairies had been declared nobility and interbreeding between “normal” humans and “Martians” was restricted, there were plenty of ELFs who had never seen Earth. And even some who had been given gene-mod for their work, which in turn passed on to their children…

“So there are plenty of people who would qualify as ELFs even if they haven’t been on Earth. And some of them would look very strange to pre-fall humans…”

“Exactly. In the beginning, some people who came out of bubbles had their genetics used to make future gene-mod. So you’ve got the Fuzzies who work in cold climates, and High-Altitude ELFs with hollow bones and larger lungs, and all sorts of ‘ELFs’ who work off-world who don’t have wings but have far stranger modifications.”

“But...we still have goblins.”

“Aye. And guess what gives you that title.”

Marianne though, though the answer seemed depressingly obvious.

“...either people who do not have modifications that were deemed ‘useful’...” She winced, but continued on, “Or who were too ‘ugly’ to fit into Martian society.”

“Got it in one, Tough Girl. This city was actually founded by Goblins before there even were Goblins. When the area was abandoned, the only people who stayed behind were the ones that hadn’t fit in with normal Maritain society. Since then, anyone who didn’t feel like they fit in ran off to the dark when it got too much...and here we are.”

“No wonder they had so much trouble figuring out how to separate out the Goblin Bubbles. The definitions were probably constantly changing. Since every mutation seems random...the computers would never have been able to anticipate what was “Goblin” until they could look inside the bubbles.”

“...or until the definition of what was “Martian” was clear enough to ban the whole lot. How do you think they separate Goblin bubbles out now?”

“...they count everything that isn’t Earth-normal as “wrong”. Because while Fuzzies and High-Alt and and all the rest exist, they’re rare, can be made with gene-mod, and have stable enough communities that no new blood needs to be inserted into the group.”

He gestured to his map, the extra ‘species’ they had added shrinking, with the Human Standard ELF and Fairy-with-Wings coming to tower over the rest.

“According to Plum, there hasn’t been a non-standard ELF brought from stasis for almost two hundred years.”

“...since my mother was the Director of the Bubble Repository.”

Bog was silent, but he did not need to say anything. Marianne could read the history as easily as if it was written before her. Her mother had been ousted from the Repository by the rest of the nobles for her radical ideas of who should be brought back. It turned out that she hadn’t been radical, just unwilling to change for the worse.

“...what about the animals?”

“Hmm?”

“You said there were no goblin animals. I’ve seen some damn ugly creatures skittering around. How come Martians didn’t get rid of them?”

Bog shrugged. “It’s not as strange as you think. Animals breed faster than humans. Just like the “goblins”, in the beginning creatures who came out of bubbles strange were used just like the rest, and anything useful was passed around to other creatures with gene-mod and intentional breeding. Sometimes those creatures got out and caused problems, but there was rarely much evidence whether something rampaging was a ‘goblin’ or a mistaken gene-mod, so everyone just assumed the latter. Nowadays, people think every strange cat is a Cheshire, and every weird bug was something miss-classified.”

Marianne was taking this all surprisingly well. Bog had assumed that his words would rock her world, and he had guessed she’d be in tears now, or screaming about his lies.

Instead, it was as if he was confirming things she had long suspected, or fit perfectly into the perspective she’d already developed of her world.

“So where does that leave you?” She finally asked. “A bunch of Fairies couldn’t tell the difference from Martian animals and Goblin Animals, so when they were looking for things to experiment on, they found a kid registered as a dog, and thought they had solved all their problems?”

“Well...they could see I had a well developed brain. Perfect to experiment on. But...I was like nothing they had ever seen before, so it made the lie easier to believe.”

“...tell me.”

Chapter Text

“Alright, Rexy. You’re going to be super brave for me, right?”

Cousin Rohan smiled big, and Bog nodded his head, trying to hold back tears, lip caught between his teeth and trying desperately to smile.

From twenty centuries later, The Goblin King can see how Rohan’s smile is just as shakey as the boy’s. How there are tears in the man’s eyes, and terror, and he makes the conversation last just a bit longer that the allocated 15 seconds, to comfort them both.

“And you’re gonna take care of Aunt Grissy for me, right?”

The boy juts his chin out an nods, hard.

“Right. See you on the other side, then, Rex.”

And the world went dark.

-------------------------------

It was difficult to describe time in a stasis bubble.

It was supposed to stop, completely. ELFs described seeing the darkness come up, then seeing the light of Mars a moment later, as if a shade had been suddenly drawn from their eyes.

For those changed by the bubbles, it was only a bit different. Some of the first to be affected by them woke up with strange songs ringing in their heads, that they could not remember hearing, but could play as if they had sung the same melody for a lifetime. Others found similar outlet in painting, or by creating strange, pulsating artwork that lightly pressed against the body.

Of those who came back able to describe with words, they described it as time moving, but the mind not. Like meditation, but more so much more complete, and without any choice involved in the mind of the observer. As if the entire world streamed through them, but left nothing behind.

Eventually, Fairies would develop abilities in the Bubble-space. To sense how much time had passed, or if they had been moved. To feel the presence of others in the bubble-space, not near in distance, but in relation, whether friend or family.

And of course, no fairy could be contained in a simple bubble. Their own wings would counteract most fields that might attempt to hold them, and only a skilled fielder could force a fairy into confinement.

But to the child-Bog, none of that was true. The Bubble descended, and the world went away, leaving behind nothing but the strange, persistent knowledge that something was changing. Had he the wings to push away, he would have shattered the bubble mere moments after it enveloped him. Had he the ability to reach out, he would have screamed his confusion to the void, calling for his mother or father or cousin for help.

Instead he hung, frozen and alone, while whatever fault that caused the Goblin bubbles leached into his very bones, and the true change began.

-----------------------------------------------------------

The first recording is ancient, crackling and faded, but clearer that any that follow.

In it, a young woman laughs.

“Row! Stop it!”

The view shakes as she reaches out for the recorder, and her partner dances away, both floating in micro-gravity, the woman’s pink hair haloing around her face.

“C’mon! I’m not going to see you again for three years. You’ve gotta leave me something of you beautiful face while you’re gone.” The man holding the camera complains.

The woman laughs again, and holds up her hands in defeat. “Fine, fine. But you wouldn’t be saying that if you saw me before the genes came off.”

“Gotta make these memories last then, right?” The recorder dips, catching a blurred view of Mars from out the window, the sound of a prolonged kiss in the background.

The planet is red, dust still bleeding from its surface into space, dark spots covering the surface the only indication of habitation, easily dating the recording from before the terraforming, Which in turn places the origin of the video on Phobos or Demios, the Martian moons which acted as spaceports before the other satellites could be constructed.

The kiss ends, and the woman floats away, twisting easily in the micro-gravity, her comfort showing her to be a true spacer.

“Well, if you’re going to be recording anyways, I should show you something!”

“Oh?”

“Just give me a second - “ A crease mars the woman’s brow as she concentrates, and a moment later a wispy cloud appears, ringing her chest and shoulders.

“Jeezus!” The man swears, flinching away.

The woman seems to miss the undercurrent of distaste in the man’s voice, for she beams.

“I know, right?” The cloud flexes, and the woman is pushed forward, forcing the recorder to jerk back again. “It’s so useful!”

“I thought you said you got rid of your gene-mod!” The man and recorder continue backing away from the woman.

“Ugh. Row, you are so old fashioned. But this isn’t mod - its something new. The brainiacs at the gene-factory couldn’t figure it out. Said they’d keep an eye on it, but not to worry. Apparently this isn’t the first time they’ve seen people come out of deep-space bubbles with weird augments. Some of them hang around after the rest of the mod is stripped off.”

“Ergh. You know how I feel about mod, Kitten.”

“I shouldn’t be endangering my pretty face?”

“Kat, this is serious. I barely get to see you as is. If you get stuck in a mod...you might never be able to return to Mars.”

Now it is her turn to push him away. “I told you, it’s not mod. That much they know. But, even if it was...it was so useful, out there on the asteroids. Just a push, whenever I needed it, even in empty space. That can save a life, out on the belt. And when I found that I could still use it, after stripping the mod? It felt good. Getting rid of it would be like losing a part of myself.”

The man sucks in a breath, then sighs it out. “...okay. I won’t bother you about it. But...could you put it away when we go to dinner?”

She laughs, and then shakes her self, the cloud dissipating as her garments ruffle into the classic spacer look, silk and gauze puffing around her until she is rumpled chic, lovely and vibrant.

“No arguments at dinner?” She asks when she’s done, all strangeness put away.

Another kiss, this time the recorder catching blond hair as the man dips her. “Of course. I’ve got to give you something worth coming back to, after all.”

And that is all he cares to record.

-------------------------------------------------------------

Suni looked up from the recording, confusion marring his face. Lady Varanus had handed him the ancient device, as if what was contained within would explain everything. But the first recording was...nothing. A home video, shot by a loving couple, centuries upon centuries ago. But the device it is saved on is strange. Its ancient, so old that its made from plastic, and feels greasy and smooth in his hands. Stranger still, it has no 'net connection and a physical screen to display the recording, allowing him to see the video even with his glasses broken.

What possible reason could Varanus have to keep such a device? He watched on, hoping to find some understanding.

--------------------------------------

“Captain?”

The video has been scrubbed, audio the only thing left remaining.

“What.” The voice is the same, but rough. Raw.

“We’re all...we’re all sorry for your loss, sir. But - “

“What, soldier?”

“...the station is requesting a report.”

Silence stretches, the grunt’s shifting the only sound.

Then…

“Tell them the ship was lost in orbit.”

“But sir - “

“Scrub the records. Delete the logs. Effective immediately, there is a full information quarantine on the Cassius. No one has seen or heard of this ship since it left, four years ago.”

“But - “

“I will be contacting the general. You will be getting this ship towed to the coordinates I am sending...now. Have a full decontam team ready when it docks. We are going to need to inspect every incoming ship for mutagen. I want records of every gene-modder on Phobos, both officially licenced and non, along with - “

“SIR!” A pause, as the grunt seems shocked that his interruption finally broke through. “...the preliminary results came back. This isn’t gene-mod.” He barreled on over the Captain’s protests, “They say...they say their bubbler malfunctioned. Something was wrong with the fields.”

--------------------------------------------------------------------

“Captain, I understand your concern, but one malfunction, no matter how tragic, can justify curtailing our use of stasis bubbles.”

“Sir, if you saw - “

“I have read your reports. I understand your lover was among the crew. No one should have been asked to do what you did. But you must understand. Mars relies upon bubble-technology. If we fall, so too does the last hope of humanity. Risks must be taken. Your lover understood that. So too did her crew. Humanity will respect her sacrifice.”

“Her humanity was the sacrifice. What they lost - no, what was stolen from them can never be recovered. And that sacrifice should not be in vain.”

“...your views on gene-mod and bubbling have been noted, Captain. As has your resignation. I hope you do not intend to take your views public. That would be...unfortunate.”

“Of course not, sir. If you would just sign the transfer…”

“Oh. I see. A return to form. Your worries will be better assuaged by our colleagues in the science division, I imagine.”

“Or they will confirm what I already know, and work to prevent it, without causing a panic.”

“Well, your solutions are always inspired, Captain. Somehow, you always seem to find the easiest course of action for everyone. It’s quite a talent.”

“Of course, sir. After all, I serve humanity.”

-----------------------------------------------------------

He wasn’t supposed to be out yet.

Those were his first thoughts when time resumed. That it was wrong to feel the light.

Not that there was much of it. His eyes wouldn’t open, and all he could sense was dull red.

Somewhere, far away, there was a piercing sound, high enough to make it through whatever had covered his ears.

He tried to move, but couldn’t.

He tried to breath but couldn’t.

Everything was wrong, and hurt, and his mouth wouldn’t open and his hands wouldn’t move and he had promised to be brave, but he was scared, scared, scared.

When the bubble returned, a moment later, he welcomed it with relief, even as he returned to the waiting stasis with newfound terror of the alternative.

-------------------------------------------------------

“Good god, Mason. I’ve never seen anything like it.”

The recording was blurry, a snap-shot of a bar, filled with muscle-bound workers indistinguishable from the rough-handed staff.

“I screamed like a fucking girl. And I don’t admit that lightly.”

A man spoke with another, leaning close together, sharing a plate filled with meat and brown bread. Their faces were furred beneath their helmets, and their eyes sharp.

“So what’d you do?” One man asked the other.

“Put it back. What else was I supposed to do? There ain’t no use in something like that.”

---------------------------------------------------------

In the present, eyes downcast and talons cutting lines into the sensitive skin of his shoulders, Bog tried to explain. “I was one of the lucky bastards who was so far outside the norm even for early Martians that they knew I was wrong. One in a million chance, they say, to end up in a goblin bubble. Well, that makes me near fucking impossible, because I turned out completely human...while still being unrecognizable. And without another goblin bubble I stayed exactly the same until Mars realized it had a monster problem on its hands.”

---------------------------------------------

“Boss! How’s the pet project going?”

There is a response, but it is filled with static, a record-scratch removing any hint of the voice behind it.

“Ooof. Yeah, I understand. All anyone cares about nowadays is gene-mod and the terraforming project.”

Another screech, as if someone had burned the data off a physical disc, and a computer rushed to fill the space with empty noise.

“You’ve got more guts than me. Two cases in fifty years? That’s gotta be, what, a one in a million flaw? Anyone else would have given up. But you...you’re the man.”

There is an answer, but garbled as the first, impossible to parse.

“Well, any time you want to take a break, just stop by the AR labs. I’ve got some interns that would be star-struck if The Codemaster himself stopped by.”

This time, the scratch sounds, almost, like laughter, but high and bitter, screeching with the distortion, mirrored by the simple human laugh of the other voice.

“Oh, and boss? I got a report of one of those weird animals you told me to look for. The ones that don’t look like anything else?”

“Do you want me to send it up?”

---------------------------------------------------------------

When time returned again, someone was prepared. There was a searing moment of aching pain, but he could breath, and Bog took a great shuddering breath that he had been needing for two hundred years.

The rest of his senses were not so dull either, and he could barely make out voices above him.

“ - remembered the grub from my time in the dog house. No extra tail, no fins, just, well that.” The voice dripped disgust.

Bog struggled, but once again could not free his arms or legs, and that would have been terrifying, had he not been exhausted from his first bout of wakefulness and just happy he could breath.

“I see. You did well to bring this to my attention, Lareau.” This voice was beautiful. Rich and masculine, like a school teacher he’d had in first grade hadn’t embarrassed him in front of the other boys by suggesting he tattled on who locked him in the broom closet. A voice that could go from understanding reproach to conspiratorial support in a second, and make one feel honored to be let in on any secret, especially one that showed how big and grown up one was.

His mother had never like Mr. Samuel, and had changed his school barely two months into his first year, for some some strange reason he didn’t understand, but the voice stayed with him, even into the strange future.

The other voice left, with the sound of a door closing, and the rich voice came closer.

“Well, let’s take a look at you, little grub.”

Something poked him, and he squirmed.

“Good reaction. Had to cut open its airway, though. Vocal cords cut. No chance of giving the game away." A pause, then, "Computer, begin official recording. Log 075 - Subject Name - Bug. Former name, “Rexy”, dog of one Griselda and Dagon King. Origin - New York City, second wave. Bubble damaged by the “phased” phenomenon. Owners afflicted by same phenomenon, deemed too likely to be be affected to bring back.”

The calm, lilting voice eased into Bog’s ears, relaxing the boy, even as he couldn’t understand what was said. Something about his parents, and bubbles. The man talked like the scientists on the TV, from old black and white movies. Maybe he knew Cousin Rohan.

“Result? Hairless creature with thick skin covering the entire body, giving it an ugly, grub-like appearance.” Bog was prodded again, this time right on the boney part of his chest. “Excess skin around one inch deep. Beneath it, subject appears to have transitioned to a more human-like skeletal structure.

“If it is in mid transition, the skin may be acting as a cocoon. Scans show atrophied skeleton, no larger than an ELF child, but with an equally large cranial capacity.”

The rolling voice continued, but Bog found himself drifting further and further towards sleep, his young body promising that he was safe now, and that everything else could wait for a moment. The last thing he heard, before he drifted off and was re-bubbled, was:

“Further testing may be required to bring subject to full functioning. But I believe I may have finally found the perfect - if hideous - specimen.”

------------------------------------------------------------------------------

“I see this project has been ongoing for...a hundred years? Who authorized this?”

“I did.”

“You - well, ah, sir, we all appreciate the work you have done for us, but a hundred years with no progress…”

“That was merely an exploratory phase, Bursar. Had you seen my recent findings, I believe you would see…”

“That you finally have enough subjects to begin the actual science? Forgive me, Director, but an error that results in only twenty subjects within a hundred years is so vanishingly rare that - “

“Setting aside that “rare” on the scale of ten billion is not nearly as unusual as one would like, I would like to point out to the Board my core subject.”

There is a gasp, and one scream from the assembled room.

“I believe I have made my case. Imagine, if you will, were that to happen to one of you. Or your children. Even if the danger is ‘vanishingly rare’...would you not do anything to prevent it?”

------------------------------------------------------------------------------

A fragment of a report, code garbled and fading, as if a copy had been grabbed while someone else was trying to erase file beneath it.

OFFICIAL REQUISITION OF THE MARTIAN GO -

A small lab shall be put aside in the ----- to be used for ----

The first undoubtedly altered specimen has been found. It, along with its entire batch, will be removed from the Repository and quarantined at ----------. All records regarding this bubble must be turned over to ----------- and then era----

Earth City of N--- is suspected origin of condi------. Avoid requisitions from rel----- areas where poss------.

Report any instances of disturbing alt-------- to G--------- immediately.

Digi--- Quar-------- Ini-------

Clas-------Le------ Al-------

And the rest fades to digital static.

Chapter Text

“I don’t know how long I spent in stasis after being found that first time. But it wasn’t long after the program director saved me that I was brought out again, in what would be my home for the next several centuries. Martain time, of course. I spent years in bubbles between research phases. But the first few months...I was kept in a cage like all the rest.”

-----------------------------------------------------------

He woke fifty years later, to the pain of his eyes being cut open. The doctors who followed after the rich-sounding man had not thought anesthetic would be necessary for such an ugly creature.

When he flailed at the unexpected pain, they simply tied him to the examination table and went about their work, cutting away thick mats of skin from his eyes, ears, and mouth.

Later, when the boy was unfortunate enough to catch a glance at a reflection, he would find himself a wax doll of a person, bare holes for eyes, a slit for a mouth, and no nose to speak of. They cut his hands apart, but only to the elbows and didn’t bother cutting between his fingers, leaving him with useless mittens.

They didn’t bother cutting apart his legs, either. It wasn’t as if he would need to walk.

“Do all the Twisted look like this?” The voice was muffled, and he tried to turn his face towards it, but the restraints kept him motionless. There had been a horrified waiver to the voice, as if the speaker was looking at something truly terrible.

With a sinking feeling, Bog realized that it must be him. Something had happened, and he’d been turned into a monster.

“It’s eyes are leaking.” A stronger voice spoke.

“Hardly a surprise. We did have to remove its eyelids. Make sure to keep the eyes hydrated, and to put a shade on when it sleeps.” The commanding, smooth voice was back, and Bog tried to gulp back his tears, hoping that the man would make things better.

“Sir, what could have caused this?” Again the high voice. Bog guessed it must be a woman, though he had yet to see anything but the blank, white ceiling to the room.

“As you said. The creature was Twisted. Though this mutation is extreme, even from what I’ve seen.” The calming voice said.

“And the genetic testing?” The third voice was probably male.

“Inconclusive.” The leader said dismissively. “I ran those tests before you arrived. Just like the rest, it’s too far off the norm to even sequence.”

“And you think we can...fix it?” The woman asked.

“What? No! We are going to study it. Find out how this happened, and if we can repeat it.”

The other man spoke, “Repeat it, sir? That doesn’t seem - “

“If we can repeat it, we can know what kind of faults cause this mutation, and prevent it in the future. As of right now, no one can chance getting into a bubble, lest they turn into that.”

Both listeners shuddered.

“What we are doing will save all of Mars. And all of you will be a part of it.”

Bog’s eyes widened as he stared upward, the words sinking into his soul, even if he didn't fully understand. Yes, this might be scary. But he could save an entire planet.

“I think we’ve got what we need. Bubble it back up, we’ve got other samples to process.”

------------------------------------------------------

“There has been a general outcry against the Martian Government by the scientific community, following another set of restrictions upon further genetic modifications. These new regulations are considered the harshest yet.

While no official explanation has been given, following the recent increase in deaths from modified organisms - most notably the Mind Plague which claimed the lives of almost four hundred Martian citizens - further regulations are expected.

Several scientists have opposed the ruling, claiming it to be an unnecessary hindrance, citing several common Martian species whose origin has been lost to time, making further work on their genomes impossible should the rules stand. Snufflers, Dragon-fliers, and Hive Builders all fall short of the documentation requirements for future testing.

However, other prominent scientists, such as the infamous Dr. Dorthy "Demon" DeWitte, have argued that unchecked modification has caused more harm than good, and warns of a future in which the inhabitants of Mars appear unrecognizable to the ELFs of today.

Speaking to her peers today, she argued -

We are no longer living in the wild west. It is time we take responsibility for the changes we've caused, and ask ourselves - is truly necessary?

While her opponents have called her histrionic, an argument supported by her frequent warnings of diseases that never manifest, the Martian government seems to agree with her point, and have held firm on the decision to restrict research to those creatures who are provably artificial.

In the opinion of this ELF, though, our leaders may want to look in the mirror before writing their rules. They might be able to trace their lineage to the oldest Martian families, but I doubt their gene pool is as pure as their arrogance."

-----------------------------------------------------

Please take this Missive as an official receipt of transfer for

Doctor with Distinction Dorothy Witte-Light, Disease Pathologist and Geneticist, Lvl Path3 Gen15

And

Doctor with Honors, Sakemoto Taishi, Veterinary Scientist and Creature Creator, Lvl Vet4 Su10 CC20

From

The University of Mars, Genetics Department

To

The Bureau of Unclassified Genetics

P.S.

Your request could not have come at a better time, General. Do try to keep Ms. DeWitte away from the limelight where possible. We don’t need a repeat of last time, do we?

-----------------------------------------------------

So the young Bog’s life as a science experiment began.

It wasn’t quite what he’d expected. He knew how things were supposed to go - his mum and da loved science fiction movies, and he had been very good at sneaking down the stairs to watch, and didn’t let on at all when the nightmares woke him up with thoughts of fly-heads and white rooms.

The next time he came out of the bubble, he wasn’t tied down. Instead, he was on the floor of a cage. It wasn’t particularly big, just large enough for him to stretch out along the floor, just tall enough for him to sit upright. On three sides were bars, while on the other side was a smooth white wall.

The floor was cold, and made him realize he wasn’t wearing anything. Then again, it didn’t really matter. The entire lower half of his body was encased in what looked like a thick, leather, diamond-patterned blanket, but when he pressed on it he felt it, just as if he poked his nose.

Because he was a six year old boy, this bothered him much less than the thought of where his pee-pee had gone. He understood that was very important for some reason.

Some curious prodding, and noticing that he didn’t have fingers, and he decided that he did still have a pee-pee, but it was under the weird skin-blanket. Ditto for his fingers. And his legs. Most everything seemed covered by the thick skin. Moving around too much made the thick plates of skin rub against each other, and the thinner skin between the joins chaff and bleed, so he refrained from prodding himself too much, and instead looked around his environment.

In the cages around him there were funny looking animals, acting much the same as he was. A dog-like creature was sniffing at itself and running claws over its new scales. That was on one side of the cage. On the other there was a snake-thing, curling in on itself, over and over, scales tinkling as it scrapped against its metallic skin. Above him there were the sound of other animals, yowls and yipps, and occasional crows. A whole zoo, and he was one of the ones on display.

Bog, who had never had a pet, no matter how many times he begged, paid special attention to the dog. It seemed bothered by its tail, which was thin and whip-like, and had a rattle at the end.

He opened his mouth to call to it, but found he couldn’t make more than gurgle, no matter how much he tried to shout.

The warm voice said something about voice-cords. He remembered, and touched his throat. He could feel stitches, and a break in his thick skin. Sir had to cut my mouth open...I guess he had to cut more too.

It was still a bit hard to breathe, since he had to do it with his mouth, and couldn’t breathe out his nose. And it made him sound silly, making little uff-uff sounds each time he breathed in.

Not all that different from the dog, really.

Unable to call out, he instead knocked on one of the bars. The beast glanced at him once, then went back to gnawing on its tail.

The bars were not particularly close together, but there was an odd wall between them, and Bog spent a few moments poking at it as well. It was weird - it clearly let some stuff through, but not others. But there was nothing else in his cage for him to experiment with, so he moved instead to the front of the cage, and tried to see the rest of the lab.

For the first time, he got a look at the people he had heard earlier.

There was a short, tubby woman with blond hair tied up in two buns on either side of her face. The other was a man with dark hair tied back in a ponytail. Both had pale lab coats on, and were looking intently at a screen.

They looked...strange. Too tall, and their ears and fingers were too long. They were pale, too. Even though the man had dark skin, it was washed out, as if he’d never been outside before. And, behind their goggles, they had wide, almond shaped eyes that were a bit too big for their face.

Aliens. He must have been found by aliens. Bog’s eyes went wide. How cool was that? He’d have so much to tell his mum when he saw her again.

The Aliens talked in their almost-human language and a machine whizzed around the room, apparently following their orders. It was made up of a long, flexible tube, attached somewhere on the ceiling above where he could see.

First, it went to a wall, and made a huge sucking sound. Dozens of black bubbles, just like the one Bog had been put in, zoomed up the tube. Then, it went to an empty row of cages and, using the pincers at the end of the tube, hit a button that opened each cage.

In went one bubble, then the door closed. Row after row it repeated, until it reached the floor and ran out of bubbles. Then it returned to up above.

One of the scientists, the one that looked like a woman, hit a button on the side of the row of cages, and suddenly they were full of rats. One per cage - Bog counted out as high as he could see - meant that there were about fifty rats, and the squeaking was deafening.

At least, it was until the woman pushed another button, and everything was quiet again. Bog could still see the rats chittering, but no sound came out. He touched his throat again, wondering if that was what had happened to him.

Probably not. It seemed reasonable to think that he had a bunch of extra skin, and that included on the inside too.

The child considered. It was clear that he was in a science lab, and was some kind of science experiment. He remembered all the bad things that happened from the movies. If he didn’t want to end up like the fly-guy, he’d have to figure out how to be a good science experiment. That meant understanding the scientists, and how to make them happy.

Unfortunately, he was really bad and making people like him. He had barely any friends in his schools, and those he did were mostly other children who weren’t wanted by any of the other groups. Teachers took one look at the lanky boy with the weird accent and could easily believe whatever the more normal kids said about him.

So he would just have to win over the alien scientists the same way he’d won over his teachers. Be smart. And quiet. And do whatever they wanted.

Convinced of this, he went back to watching the scientists. Understanding their language was step one. It sounded enough like English as to feel familiar, but with many odd words. A bit like the time his da had taken him to the edge of Chinatown, and people spoke a mix of Chinese and English.

His Da ran a delivery business, so Bog had been all over the city, and had heard lots of strange languages and pidgins. If they had all been swirled together, they might have sounded a bit like what the two scientists spoke.

But there was enough of English left that he could understand some of what was said, and tried to piece together the rest.

It was easier when they spoke of non-science things, he found. When they spoke about attributes of the animals, or things called ‘fields’, the words they used sounded as if they were reading off the ingredients off the back of a pill-package. His mother had done that a few times to get him to go to sleep when he was small, droning off the scientific names of prescriptions until he nodded off.

So it was no surprise that he nodded off when the two spoke of complex science-y things. But it was hard to concentrate even when they were talking normally. There was just so much other stuff happening in the lab! Any wall without cages had desks full of strange science equipment. Things floated and bubbled, other things whirled and whizzed, and everything worked with a spooky silence that hinted at construction very different from the Earth norm.

Plus, there were no cords. It was such a little thing, but there were no plugs, cords, outlets, or even light switches in the whole room. A fair cry different than Bog’s own home, with its octopus like television and computers that everyone carefully tiptoed around lest an uncareful breath cause the whole mass to rebel and leave them without television for a whole week.

But there were surprisingly few screens as well. Certainly the scientists glanced at machines when they beeped, and added or adjusted devices, but there were very few blinking readouts, and even those machines - mostly older ones - that did have readouts were rarely glanced at.

Instead the scientists seemed to understand whatever a machine said without any reading.

More proof that they were aliens. They were telepathic!

Slowly, Bog learned more.

Names, at least, were obvious. The blond scientist was Dorthy, like the girl in the Wizard of Oz, though she normally went by Dor. The man was Ty, short for a longer name that Bog couldn’t quite remember, but sounded like it came from a Samurai movie.

He couldn’t figure out the name of the Sir, because whenever they spoke of him their voices went low. Something that began with R. Bog decided to call him Rohan, just like his cousin.

Dor and Ty were friends, that much was obvious. They laughed and shared coffee, and both complained about the other’s preference, as was obvious by whenever they picked up the wrong cup and immediately sputtered indignantly about the taste. And they seemed efficient enough, moving around each other in a kind of dance, not minding being in the other’s space but never being in the way.

A bit like when da and his workers packed a truck, but with a lot less yelling and a bunch more questions.

But sometimes, they would pause, randomly, staring off into space, eyes unfocused. It was a bit creepy, but the other scientist would never act surprised, and whenever the frozen one came back it would be with renewed purpose and efficiency.

Another point in the telepathy camp, then. Sometimes they made gestures with their hands when they froze, and it looked like magic spells, all flickering and jabbing motions, with no obvious effect.

It took two weeks before Bog connected the motions to reactions from the machines, but eventually he noticed the more directed commands and linked them with machines coming awake and running a new test.

In those first weeks, he learned far more about himself than his scientists. Which made sense, given that both he and they were studying him, and they didn’t try in the least to explain themselves to him.

They had fed him, the first day, a machine dispensing a grey goop into a bowl after pushing him back from the door with the same clear wall that divided him from the other animals. The plate couldn’t be moved from the floor, not that it mattered because he wouldn’t have been able to reach it with is mouth if he picked it up.

But the scientists weren’t watching, and so he ate just like the dog next to him, suddenly starving the moment he swallowed the goop. With no clock or calendar on the wall, he had no idea how long he’d been in the bubble, but he figured that he’d earned a meal, even if it made him blush with embarrassment to be eating off the floor.

The idea of his mum, and her home-cooked meals, indulgently smiling down at him as she spooned more soup into his bowl, loomed large in his mind, and he could feel the panic well up as he forced himself to eat the tasteless slop. He tried to battle it down, reminding himself that his mum was back in her bubble, just like the man with the nice voice had said, but it wasn’t enough, and he found himself with thick tears rolling down his face.

Ashamed, he tried to wipe at his face, with not much effect, only managing to rub a rough knuckle over an unblinking eye. He didn’t need to blink. But not being able to close his eyes and welcome the darkness back was scary in its own way.

He hated the sounds he made when he cried. He hated the fact that he cried at all, showing how he wasn’t brave enough for Cousin Rohan. He hated how, no matter how far he curled up into the back of his cage, there was no escape from the light. He hated how it hurt when he scrunched his eyes up, barely blocking out the bright light of science.

He sobbed, unnoticed by the scientists, until he fell asleep, and only woke again when he was taken out of another bubble.

Chapter Text

“How many?” The voice was grim, but rang with authority.

“A couple dozen. Mostly from highly populated cities near the initial impact sites.”

“Is there any indication that it is contagious?”

“None, sir. They just come out...changed. A bit like Cheshires.”

There was a bark of pained laughter, and a smooth voice added, “If by “a bit” you mean so twisted as to be unrecognizable.”

“Enough, Director. There have been alterations before. What makes this any different from our bubble-gifted abilities?”

“Beyond the physical extent of the changes…”

“We don’t know.” The smooth voice cut in. “But I have scientists on it. They will find out the cause of the disease. And what dangers it poses to Mars.”

“Very well, Director. See to it.”

-------------------------------------------------

He wasn’t a very good scientist. A good scientist would have thought about what would happen after he ate.

But the alien scientists had thought of it. He woke again when the bubble popped, and the blessed darkness was replaced with searing white light, and the faces of the two scientists far closer than he had yet seen.

“This is the last one.” Dor said.

“Aye. Shouldn’t be too hard.” Ty replied.

The words were simple enough that Bog could kind of understand them, so he anticipated the pain. It was short, sharp, and somewhere above his groin. A moment later, they flipped him onto his stomach, and the pain repeated, lower this time.

The darkness returned a second later, and then he was in his cage. A quick examination showed that they had put some strange device on his belly, made of a tube and a tiny white bubble. Something that felt similar was low on his behind. And he no longer needed to go to the bathroom.

Thoughtfully he prodded the area, and received a sharp zap for his curiosity.

One embarrassing problem gone, then.

Next to him there was a pop of out-rushing air, and the dog was there again, filling the cage with grumbles and whimpers and nosing at its groin as well. So Bog wasn’t the only one.

He wondered if they’d give him a blanket next, or some kind of shade so he could close his eyes.

Instead, they left for the day, and the lights shut off behind them, leaving the whole lab pitch dark.

Bog knew that normal children were afraid of the dark. But he’d been locked in enough closets at his first school to be used to it. A prod to the cage walls showed that the clear barrier was still up, protecting him from the other animals, and their murmuring and rustling was loud enough that he could almost pretend it was the traffic outside his parent’s apartment. After a day wincing away from the light, he accepted the darkness easily, and with some relief.

-----------------------------------------------------------

The recording is scratchy. Old. Unnumbered. But those speaking are labeled.

Doctor Dorthy DeWitte
Doctor Ty
General ---------

The name is the one thing marred on the recording, as if it was just an error that erased a name, not intentional malevolence. But it is part of a pattern, if one knows where to look...

“A genetic census? That seems a bit...harsh, sir. Not something the ELFs will like, either.”

“What does it matter what they like? We’re not going to cull anyone. Just...make sure everyone is close enough to the norm to be protected by normal medicine.” The woman smiled at her friend, then looked back to her master.

“And you came to me for this?” The Asian man looked unconvinced.

A smooth voice said, “You’re the best the world has to offer. Dor’s got this idea - maybe an insect could collect the data for it. Something small. That no one would notice. And if they did...well, it’s not as if we still need the damned things around. Be a good excuse to get rid of that memory of Earth.”

Ty looked between the General and Dor. “...if this ever gets out, our careers will be ruined. What could possibly be worth it?”

If one finds the record, looking through old files for legends or history assignments, then the knowledge is already there, of the horror and outrage of the Martain populace to have their very genetics stolen and sequenced, and of the two (but not three) careers which were irrevocably damaged.

But who else would have taken such a dangerous job, studying monstrous creatures affected by an unknown disease, but someone truly disgraced? How lucky, for Mars, that the study, once so well hidden, had been leaked by a careless mention from one of the highest authorities...else no one would have ever known, and the monsters that perpetrated it would have remained comfortable in their positions, never thinking to leave.

----------------------------------------------------------

He was bad with time, but counted the days out as periods between when the lights were off. The scientists left them on when they went out for breaks or to get other equipment, so he figured this was more or less accurate.

The first week, he tried to learn their schedule as best as possible, and not to bother them when they were running tests.

Dr. Ty and Dr. Dor were very thorough with everything they did, and often saved him for last, so he was able to watch every test that they ran. He learned about the other creatures in the cages above him - some birds with all their feathers gone, some scale-y looking things which had grown big big teeth, and even some insects that were much larger than he remembered from Earth. There were other dogs, and a few rabbits and gerbils, but no cats for some odd reason. Maybe they were just too changed to recognize.

Ty and Dor took samples of just about everything from the animals. Hair. Skin. Blood. Even gunk from their eyes and spit from their mouths. Most of the animals didn’t like it much, but they had some kind of strange device on the table that stopped anything from moving.

Bog had thought he’d been strapped in, the first time, but from the outside it didn’t look like that. Instead, they pushed a button and a shimmery barrier, just like the one on the cages, held the animal in its position. The metal instruments the doctors used could move easily through the barrier, but apparently living parts could not. At no point were the scientists and the animals ever even breathing the same air, as they manipulated all the instruments through another one of those strange clear barriers.

Being so constrained terrified the animals, but the scientists didn’t seem to care, only grumble if the creature hurt itself in its struggles.

Bog made sure that he was very good when he was on the table. It wasn’t as if they were doing anything that hurt. Mostly they poked and prodded and did things like shine light into his eyes. He was quickly losing his embarrassment, as the scientists didn’t seem to care if he cried or not, and hadn’t even noticed when he’d made himself sick with over-thinking the third night. A machine cleaned that up, and nothing at all was said about it beyond, “Note it on the record.”

That he heard so often that he had it memorized, even before he understood what it meant.

So he was good, and learned Dor and Ty’s schedules as best he could. Ty almost always arrived first, and waved a hand at a machine that made coffee to start it up. Then he would sit at an empty table and wave his hands around. Bog couldn’t see where he was looking, but could recognize the gestures as interfacing with some kind of computer system.

It took a few weeks, but he remembered something about Martians. Something about how they were always connected to the internet. Like they had their phones in their head, instead of their hand. Bog’s family had never been able to afford such technology, but there were a few children he knew - mostly rich kids that had gotten kicked out of better schools - that said they could watch cartoons on the ‘net and the teachers couldn’t tell.

Dr. Ty didn’t look like he was watching cartoons. He looked all serious when he worked, like Da did when he looked over accounts, his gestures all precise and focused.

Dr. Dor was not so precise. Bog thought of her a bit more like a butterfly, flitting from place to place, or maybe like one of the yappy dogs that the fancy ladies carried that always seemed to hate him on sight and found it impossible to sit still.

She was always moving, pacing even when she got the far away look in her eyes that meant she was connecting to the ‘net. Dr. Ty made sure to keep machines and cups away from the edge of the counters, lest she hit them as she moved, gesturing widely, her voice booming even when it didn’t need to.

She certainly was as dramatic as the little lap dogs. She didn’t hide her distaste for the creatures in the cages, specifically the more insect-like ones. Each time she sneered as she was speaking, Dr. Ty winced.

Bog didn’t think he looked very insect-like (more like a worm, really) but she turned the same distaste on him, flinching each time her eyes wandered over his form, and choking whenever she caught sight of him staring.

It wasn’t necessarily a bad thing, because she could call up a shade on his cage, which let his eyes rest for a bit during the blinding day.

He was good, he thought, for a whole month. He tried not to stare at Dr. Dor, and didn’t complain when he was on the table. He was quiet when Dr. Ty looked at him, poking and prodding, never lashing out like some of the other animals or trying to escape.

Even though he was terribly bored, he put all of his mind to listening and learning the scientist’s language. He knew it would be easier, if he could picture the words in his head, but he hadn’t gotten good at writing yet, and his mouth wouldn’t make the words, so he couldn’t sound anything out. The best he could do was only accidental, like when he found himself crying in sometimes, sniffling into his arm and whispering muh muh muh, the closest equivalent of ‘mum’ his broken voice could make, reminding himself that she was still out there, somewhere, and if he was good he might be able to see her again.

But...he was still bored. When the scientists weren’t talking, when they were just staring into space, he couldn’t learn anything at all. By the fourth week, he could understand the weird behavior of the other animals. Sometimes he poked himself, just to feel the way his strange body moved, and only stopped when his skin broke, and red blood reminded him that there were somethings that were the same as before.

No wonder the dog gnawed on its tail, and the snake scratched against itself until it shed scales. There was nothing else to do.

He tried to be good. He really did. But during the fourth week, half way through Dr. Ty’s second cup of coffee, Bog saw green blood pooling on the floor of his neighbor’s cell.

The dog had finally managed to gnaw through the armor on its tail. Now it ripped at torn skin, the flow of blood increasing each time it jerked its head, and for a second Bog saw bone through the gash.

He pounded against the bars, but the beast didn’t stop, working at the armor with mad determination in its demented eyes. He screamed, but the dog ignored him, and of course the noise did not reach the scientists.

Hands shaking, he pounded, uselessly, against the bars. He liked the dog, even if it only ever growled at him. He liked the snake, with the soothing sound its scales made. In a stupid, perverse way, he felt like they were all in this together.

He didn’t want the dog to hurt itself. But there wasn’t anything he could do.

Desperately, he turned his pounding to the front of the cage, his own hands beginning to bleed as the motion upset the seams of skin. He didn’t care. He needed to do something, anything, to catch the attention of the doctors.

With all his meager strength and much stronger focus, he slammed his hands against the area around the door, not caring if he hit the bars or the barrier between them.

Once. Twice. The dog whined, and he heard the horrifying rip of flesh, and for a moment his mind went blank, focused only on the desperate need to help.

The third time he hit the door, something snapped.

The sound of thirty cages of animals roared into the room, and both Dor and Ty dropped their equipment, glass shattering on the ground and whirling towards the sound.

His hands fell through the barrier, wedging between the bars, and he did his best to scream at them.

Dr. Dor remained motionless, her coffee splattered across her front and her cup smashed on the floor, but Ty was already moving, rounding the tables and kneeling to help free Bog’s hands.

The boy screamed at him again, frustrated that the man couldn’t see the creature in pain right beside them, and thoughtlessly grabbed the Ty’s arm and shoved him towards the dog’s cage.

“D’ggggg!”

The word was garbled, more moan than a sound, but the motion, at least, made the scientist look in the right direction.

“Fuck!” The man swore, a word that Bog actually recognized for once, and then the dog disappeared into a bubble. A moment later, the darkness swallowed Bog as well.

-------------------------------------------------------------------------

Urgent Correspondence -- Highly Classified -- Do not Duplicate

It has come to our attention that at least one of the “twisted” specimens has abilities consistent with Ascended ELFs / Martian Natives. Current suspect is subject “Bug”. Please see attached footage. Subject appears to break a containment barrier through physical force. Ability consistent with that of Ascended Cheshires and Hivers.

General, if these creatures are akin to those already existent, simply with greater outward physical changes, should we not bring this to the attention of the Martian government? We have yet to find the source of this disease, if there is one. Panic is setting in among those who already know. This could allay their fears...or worsen them.

How would you like us to proceed?

Sakemoto Taishi,
Tenth in Medicine,
Fourth in Veterinary,
Surgeon of the Martian College of Science

------------------------------------------------------------------------

When light returned, Bog found himself back in his cage. He guessed that not much time had passed, as there were still shards of coffee-cup on the ground.

He pushed himself up to a sitting position, and from there towards the front of the cage.

The barrier was back, but he could hear Dr. Ty and Dor talking. The dog was on the table, and Ty was wearing a mask and gloves while he worked on the dog’s tail.

Dr. Dor was looking over the procedure with her arms crossed and narrowed eyes.

“ - n’t believe you touched that thing.”

“Dor, I am trying to concentrate.”

“Who knows what diseases it has! And you touched it! Just breathing the same air was bad enough! He will be told about this.”

“I’ve already sent the recordings over.” Ty said, clear irritation in his voice.

His words stopped Dor for a moment, and her hands clenched on her lab coat, before she continued. “Well of course. He can’t expect us to work in such a dangerous environment.”

Ty snorted, then eased away from the table, clearly looking over his work.

“No, Dor. Because the Bug broke the barrier field.”

Dor glanced in Bog’s direction, and he barely turned his head fast enough to hide that he was watching them. But he caught a glance at the ever-present disgust on her face nonetheless.

“You don’t know it was the bug. Ugly slug-like thing probably doesn’t have enough of a brain to do it.”

“The scans show otherwise, Dor. And He picked it for a reason. None of the other animals even tried to get out.”

He nodded at his work, then waved a hand, and a bubble appeared where the dog had been. He handed it off to one of the ceiling-machines, and then went to remove his gloves and mask by the sink.

“Either way, one of them broke the barrier. If they are capable of advancing in the same way as other Martians, then this disease has become far, far more dangerous.”

Dor grimaced, her eyes scanning the rows of cages, normal arrogance replaced with real worry. “Then I was right all along.”

-------------------------------------------------------------------

A ball appeared in his cage after the incident with the dog. All the animals got one, and Bog was a bit embarrassed with how long he played with it before returning to his observations. The dog was even more enchanted, bouncing its toy for hours, and worrying at it with its teeth just like it used to chew on its tail.

The snake, in comparison, glanced at its ball once, and ignored it completely. Bog didn’t blame it. The toy wasn’t all that interesting. It didn’t light up, or make noises, and it certainly didn’t have a lot of fiddly parts, like all his favorite old toys did. But he spent hours bouncing it, and finding ways to ricochet it into his food bowl in a game that was almost - but not really - like basketball. It was even nice to cuddle with at night, even though he was far too grown up to need a teddy bear any more.

The scientists were clearly bothered by what Bog had done, and for days after the event spoke in low voices. Dor was even more irritable than usual, and on at least two occasions there were more dropped glassware and one actual verbal fight that had Bog huddled in the opposite corner of the cage, terrified of what might happen should the blond scientist decide to take it out on the animals.

But on the fourth day, something had apparently changed, because they both appeared early, Dor with deep circles beneath her eyes, Ty already with a cup of coffee, and they set about cleaning the place up.

Not that there was much to clean, given that the machines did most of the work, and there were no papers or pens. But Dor bustled nervously around, moving bits of equipment back against the walls, while Ty gestured expressly into the invisible internet to do his own cleaning.

Bog guessed it took about two hours until their guest appeared, during which time Dor had completed a good thirty circuits of the room and Ty hand downed four more cups of coffee.

And then he walked in.

Bog knew instantly he was the man with the smooth voice. He looked like it. Wavy blond hair, bright green eyes, a completely casual swagger to his walk and a smile that toyed with being a smirk.

He was beautiful, in the way that the models on the covers of magazines were beautiful. Handsome, masculine, and he even carried a sword on his hip.

Bog’s eyes went round at the last detail, pressing himself against the wall of the cage to see more. The man looked so cool. Like a hero in a cartoon, the kind that always would save the day and get the girl. Like a pirate, or a knight, or maybe a superhero.

“Dor. Ty. I understand that you have found something interesting.”

For some reason, his words were so much easier to understand than the scientists. Perhaps it was his accent, making his voice rise and fall, wide round sounds dripping easily from his lips.

Dor and Ty were both at the man’s side instantly, Ty bowing deep and Dor immediately launching into a tirade.

Bog only became more impressed when with a single wave of his hand, the man silenced the chattering woman.

“I have read the report, doll. And all your worries about safety. Y’all know that’s my highest concern.” He patted her lightly on the shoulder, and she flushed, for a moment looking twenty years younger as she drank in the assurances.

“Now. About this Bug. How’s my protegee doing?”

Dor giggled, high and derisive, but Ty spoke up. “It broke the barrier, sir.”

“Or the Droog did.” Dor interrupted. “You have no proof - “

“Other than it was banging on the bars before the field snapped. And it only started that when it saw the Droog had injured itself. So it may be showing signs of compassion, along with - “

“Do you see?” Dor smoothly interjected, the whine in her voice easily cutting over Ty’s low baritone. “This is what I have to put up with, Sir. This ELF-brain treats the Twisted as something more than monsters that need to be culled. Looking for something when its not there. Next he’ll be saying that when the Bug cries and calls out to its mommy.”

“The recordings…”

“Enough.” The man’s voice cut through the two’s bickering. “Please give me some time with the subjects.”

“Sir?”

“I need to examine them myself. Alone.” At the scientist’s confused looks, he added, “I was a scientist, once. I should be able to determine if any of these creatures has the potential for fielding, or if they have any worrying sentience.”

“...oh. Of course!” Dor said, clapping her hands together loud enough to make Ty wince. “Come, Ty. The General needs to work his magic!”

She grabbed the other scientist’s arm, and dragged him from the room. The “General’s” warm smile stayed on as they left, and did not even waiver as he turned to the cages.

Bog crouched back, well aware that his form disgusted and not wanting to chase the handsome man away.

The man’s legs stopped about half an arm’s length from the wall of cages, and he was clearly examining each animal with interest, top to bottom. Bog shrunk more, knowing that disgust on such a handsome face would wreck him as surely as the look of disappointment from his father when he’d failed a simple task.

Lost in his dark thoughts, he was shocked when he glanced up, and found the man staring intently at him, crouched on his heels.

“You are an ugly one, aren’t you? Worse even that I remembered.”

Then, in an impossible impropriety, the man leaned back and thumped onto his ass, ending up cross-legged in front of the cage, and there was only a bit of disgust in his eyes, hidden by a wry grin.

“Hello, little Bug. My name is Roland.”

Chapter Text

Roland, the Green Knight, General of the armies of Mars, and a bunch of other titles that he waved away with a flippant hand to show just how little he cared about them, introduced himself to Bog, and the boy tried not to cry.

It had been nearly a month since anyone had spoken to him. The last thing had been Roland’s voice, from fifty years earlier, when he’d first been “discovered”.

“You’re a kid, aren’t you? Just nod yes, I know you can’t talk.”

Bog nodded quickly.

“Do you know why you’re here?”

He shook his head, hoping the man could understand ‘no’ as well as ‘yes’.

“Right. Of course not. They didn’t know much about bubbles five hundred years ago. Ah ’course you couldn’t figure it out.”

There was a light criticism to the words, and Bog thought guiltily of what little he had picked up from the scientists. He knew he was something called Twisted, which had to be bad. And that was why they were studying him, and the other animals. To protect Mars from what had happened to them.

But it wasn’t as if he could express that, so he shrugged, helplessly.

“Its okay. Its impressive that you’ve kept up at all, ELF like you.” A pause, then, “Oh, that’s what they call people from Earth. That’s where you’re from.”

Bog jerked, jutting his chin out and glaring. He knew that at least!

The man - Roland - laughed, and it was an amazing sound. Warm and welcoming, as if they were both sharing the joke. “Okay, okay. You know Earth. But do you know why you ended up -” a gesture at the boy’s body. “- like that?”

Bog’s smile faltered, and he shook his head.

“We don’t know either. We just know that some people end up, well, ugly when they come out of bubbles. The thing is, it hardly ever happens to animals. The ones in this room? They’re the only “ugly” animals I could find after searching for fifty years. And that’s Martian years. So a hundred ELF years.”

Bog’s eyes went wide, and he stared at Roland. He didn’t look a hundred years old. He didn’t even look half as old as his mum, and she was the prettiest lady ever.

“And you...well, it’s not hard to see why a mistake was made. You’re...well...you’re really ugly. Worse than anything I’ve ever seen before. Still. I would have never made you go through this if I’d known.” Roland looked up at him, face serious and eyes swimming with deep emotion. It was clear he felt terrible about what happened to Bog.

“But...maybe this happened for a reason. You can help me, Bug. And we might be able to do something great. You see...there’s got to be a reason animals don’t become ugly. Right now...the best guess is because animals can’t be bad.”

Bog froze. If everything Roland said was true…

“I can see what you’re thinking. It’s no mistake that some of the biggest, baddest cities are the ones that have the most twisted. You’re from New York, right? Would you say that was a good city?”

Bog thought about it, and had to admit it made sense. There were a lot of rude, mean people in his home city. His parents were always warning him about all sorts of bad things that could happen if he wasn’t careful.

But...if only bad people were made into monsters…

“Now, I don’t think that’s what’s going on. But most people do. So they’ve made a rule that no one is allowed out of the bubbles that might be corrupted. That means no one from New York, or Beijing, or Lagos, or Tokyo …”

Bog swallowed. Despite what Roland seemed to think, he wasn’t completely stupid. He could see where this was going.

“M-m-muh…”

“Eh? Oh. You’re worried about your Mom aren’t you?”

He nodded, suddenly terrified about what this man might say.

“She’s safe.” The boy gasped in relief. “For now.” Bog’s eyes widened. “I have your mom and dad safe in my office. But I can’t protect them, if the government decides that all the people in the bad bubbles should just...go away.”

There was absolutely no question what the man meant when he said that. Go Away meant forever. No coming back. Like with gramma and pappy and uncle Gary after the accident.

“But! With your help, I might be able to prevent that.”

Bog was instantly at the edge of the cage, hands clenched and look of determination on his misshapen face.

“You see, I think that bubbles answer to the mind. That’s why some people get super powers.”

Bog’s brow creased.

“You know, like Dr. Dor and Ty. You’ve seen them do magic, right?”

Bog’s brow was still creased. He’d figured out that the two scientists were connected to the internet all the time. That wasn’t magic, it was science.

“Or how ‘bout this?” Roland waved a hand, and suddenly a silver-white bubble popped into existence, then dissipated back into the air.

Bog’s eyes widened.

“Yeah. Martians can control all sorts of fields. Not just the ones that connect them to the over-net. That comes from being in bubbles. But no one can go back in, until we know for certain no one will come out looking like you.”

Bog nodded, understanding that, at least.

“As I was saying. We've known the bubbles do strange things to the mind. Now we know that they do strange things to the body. What I want to prove is that you can control the changes. If we can do that, then no one need ever fear going back into a bubble! And if that’s the case, then surely your mom wouldn’t be Twisted, because she would have to want to look like that.”

Bog’s eyes widened. To his young mind, it made a certain amount of sense. Everyone called him ugly. He hadn’t been able to fight that back home. He’d thought it plenty of times, too. So now he really was ugly.

“Anyways, I think that’s far more likely than a kid like you being bad, right?”

Guilt surged through him. He’d done all kinds of bad things. Stolen cookies out of the cabinet after dark. Broken da’s favorite power tool. Gotten the other kids in trouble when they’d pushed him into the creek. A list unrolled in his mind. Maybe he was a bad kid.

That, or he wanted to look like this.

Neither option was very good. But from what Roland said, it didn’t really matter what happened to him. What was important was what happened to his mum. It wasn’t her fault he was bad. Just like it wasn’t her fault he was ugly.

He had to protect her. Just like Cousin Rohan had said.

With newfound determination, he returned to the door of the cage.

“I see you understand. So you’re going to work with me? To help prove things like you aren’t bad?”

Bog nodded, decisively.

“Alright. I’m gonna trust you. Don’t disappoint me, okay?”

He nodded again, and was favored with a smile on that handsome face.

“So this is the plan. You’re gonna stay here, and keep being a science experiment, while I work to keep your family safe. You’ve got the easier task, trust me. But you have to keep Dor and Ty from finding out you’re human. If they do...well, it will prove Dor’s theory that all Twisted are bad. So you’ve got to be really, really good. No more trying to talk, no more bursting fields. You just be good.”

“And, any time you go back into a bubble, I want you to concentrate.”

“Wh- wh- “

“On what? I’m glad you asked.”

Roland pulled a card from his pocket. It looked like a postcard, of the kind that were all over New York, sold for exorbitantly high prices that the tourists eagerly paid.

On it, was a picture of a man. He was tall, with skin darkened in the same way as Ty, with a weathered face and a thoughtful cant to his brow. He was dressed strangely, in a far more elaborate costume than what Roland wore, but one that looked...regal.

If Roland was the Knight in Shining Armor, there was really no doubt who this man was.

King Javier II

That much Bog could read, and it confirmed all his expectations.

What didn’t, were what grew out of the man’s back. Bright green and vibrant, the swaths of color didn’t translate easy to the camera, but even on the static photo the colors seemed to shift and roll, giving the impression of motion.

“All the most powerful Martians have wings.” Roland explained. “You can’t be King without them. And if you make me wings, I will free the goblins.”

--------------------------------------------------------------------------------------------

Did you see? The new picture of the King?

Oh stars, yes. They plastered it over every surface of the city. Tasteless, if you ask me.

But is it true?

That he has weird-ass fields growing out of his back? Yes. I’ve seen them.

But isn’t that…

Weird? Didn’t you hear? Only real Martians have field-wings. Guess everyone else is stuck with limitless energy and perfect storage containers. Boo-hoo. At least we don’t have proof of being inbred oligarchs growing out of our backs.

That’s not what I meant. Given all those rumors about weird bubbles...showing a Difference like that is kind of...I dunno, cool.

Ugh. I can’t believe I have a royalist for a friend.

Hey, I’m allowed to enjoy it! We’ve only had a royal family for what, a hundred years?

Human years.

Whatever. I think it’s fun. It doesn’t mean anything.

Uh-huh. You say that now. Wait until everybody has wings.

-----------------------------------------------------------

“General? What have your scientists found?”

“Nothing yet, sire.”

“So the disease is nothing simple. Is it as bad as they say?”

“Worse, sire. The scientists...well, they have less caution than they might, even those like DeWitte. They’re keeping the quarantine, but it’s a close thing. We’re lucky the pathogen has yet to infect any modern bubbles.”

“So they do believe it’s a pathogen?”

“You know scientists. They don’t say anything for certain. But…”

“...we need to protect our citizens.”

“Exactly. As hard as it is, we need to prevent anyone from those cities being Awakened. And I do strongly recommend implementing the Bubble-Ban…”

“I cannot bring that to the council. You know that. Mars runs on bubbles, and to ban them without explaining the situation would be untenable. Revealing the Twisted would be far worse.”

“Your husband does not seem to agree.”

“Javier...has too much hope, as you have always said. But I will speak to him about the Ban. About the danger.”

“That’s all I can ask, sire. Please. Do it for Mars.”

Chapter Text

Things didn’t change much for Bog after his talk with Roland, except that now he knew who Ty and Dor were referring to when they mentioned Sir.

He was careful around Dor, as he always was, making sure that she never caught him watching her. He tried to act more animal-like as well, crouching more and trying his best to never make sounds that might be misinterpreted as speaking.

Roland had explained that Dor had complained to him, privately, that she found it creepy when Bog cried himself to sleep calling for his mum. Roland had looked understanding, but requested he stop bothering the scientist, and reminded him that big boys didn’t cry.

Bog was terribly embarrassed, but he promised with emphatic nodding that he would do his best.

Now Bog was trying to anticipate before he was put into a bubble, which was very hard, given that the scientists could do it at any moment, for any reason, and he could barely understand them speak, much less see the information they could. It became irritating how infrequently they bubbled up the caged animals. They seemed completely fine to let the creatures sit, bouncing balls listlessly or banging limbs against the walls, rather than do the easy thing and keep everything stored properly.

Maybe they were scared that some of the bubbles were messed up, rather than the minds behind it wrong. After all, they were scientists, and couldn’t count out even things Roland thought were obvious. They talked back and forth about that theory a lot, now that Bog was listening for it. What caused the disgusting, ugly creatures, and why, was the entire point of their work, and Ty at least was willing to entertain any possible explanation.

Dor matched Roland much closer, convinced it had something to do with “evil” or “madness”. Bog guessed both might apply to him, though they seemed a bit strong.

Still, he renewed his efforts to understand his caretakers, and was rewarded by the obvious answer, at least. He was always the last taken out for tests. That meant he had a good hour’s warning to prepare for the bubbling as they worked on the other animals.

Just as Roland said, he tried to concentrate really hard in that time on the idea of wings.

It was hard. He’d only seen the postcard for a moment, and the wings the king had weren’t captured well by the camera. They were too...shifty. Half there, half gone. How was he supposed to concentrate on something like that?

The second problem was that it was hard to concentrate on something else when he was uncomfortable. His skin itched, and his arms couldn’t reach to scratch. The bright lights were blinding, and he couldn’t hide his eyes. And of course he was always nervous as to what the scientists might do to him.

Ty and Dor had begun their experiments on the rats in the cages, and they started by vivisecting one. Bog had nightmares for days afterwards, the sounds of the creature’s screams burned into the back of his mind. Apparently it was the beginning of the next stage of the experiment, because they had started the day after Roland left, and the thought of the same thing happening to him wrecked his concentration for days.

Still. He tried his best, rolling the word wings around in his mouth, trying to force it to make the shape despite the way his throat burned whenever he tried to speak. He imagined what he might look like with wings like the king, and tried not to flinch at the thought. A creature like him wouldn’t look right with something so regal. After all, he was a gross, ugly bug, and the scientists and royals were higher beings.

There had been a time when Bog had loved insects. He had a whole collection of picture books about bugs back home, and he had been proud at how many of the long words he could sound out. He’d realized that was wrong when he’d brought one of his favorite books in to show-and-tell, only to be met with screams and retching sounds from the class when he showed a picture of a caterpillar being eaten by a spider. Bugs, Mr. Samuel had explained, were not things appropriate for class, along with all the other ugly and icky things in the world.

He’d gone home and put away his bug books, and brought a book on swords the next day, which was liked so much that some of the other kids took it and he didn’t get it back, which was okay because for once they didn’t shove him into a closet. After that he stuck to books on ‘cool’ things like knights and swords and tanks, and not bugs or other icky stuff, at least until his mother made him go to the new school with the teacher who laughed at dirt and picked him up when he was pushed down and never ever told him to ‘man up’.

Still, even if Miss Gretchen had liked bugs, he knew other people didn’t, and that there was no better name for him to convey the disgust Dor and the rest felt when they looked at him. He looked like a worm half squished on the sidewalk. Not at all like a cool dragonfly or butterfly.

So it was hard to concentrate on pretty wings, when he wasn’t sure if he deserved them. But he tried, doing his best to imagine the shifting blue and green each time the darkness came up. Sometimes he timed it right. Other times he caught himself wanting to itch his nose, or blink, or even just go to the bathroom normally. Other times he didn’t imagine the right wings, filling his mind with doves in flight or the shimmer off of a fly’s wing, and that was nothing at all like what Roland had wanted.

Two months he failed, frustration and disappointment dogging him each time he found himself back in his cage, but with no tickle on his shoulders that hinted at success.

So he watched, and waited, and learned more of the language and the experiment, doing his best to predict the unpredictable, and force the impossible.

-----------------------------------------------------------------------

In a surprising move, the government of Mars has moved to officially draw a distinction between Earthling species - colloquially known as ELFs - and any and all genetically modified species, which have been officially designated as “Martian Natives”. This move has come after recent restrictions to unsupervised gene-mods. A third of all deaths on Mars over the last hundred years have involved a genetically modified organism.

No statement has yet been made on the recent Awakening Quarantine which has restricted Awakenings from population-dense areas of origin. There is no indication that this Quarantine will be lifted soon, and family members requesting to be returned to bubbles to wait for Quarantine to be lifted have had their requests denied.

In a final, apparently unrelated, announcement, a spokesperson for the government, Prince Consort Pierre Velazquez, requested Martians limit their Field use while further research into the cause of the Quarantine is investigated. No official ruling has been made, but given recent events, further regulations are expected.

Concerns have been raised by activists about government overreach, but rumors abound that these regulations are not indicative of a new policy approach from either Head of State King Javier IV or from the wider council, but rather reflect a new threat the government is currently preparing for. Restructuring within the government research department seems to support this claim.

But what could tie such disparate subjects as gene-mod, Awakening, and Field-use?

-----------------------------------------------------------------------

One day, when he came to, the lights were off.

His first thoughts, as they often were, were of the fact that he’d gotten caught wincing at the light and wishing for his eyelids back, rather than wishing for wings.

Then he realized he was still in darkness, and a small part of him nearly wept with relief. Rarely after an exam were the lights turned off, and he often would find his eyes stinging for the rest of the day, unable to repair themselves after staring into the bright surgery lights when he could barely reach his face to cover one eye with a hand.

When the darkness didn’t abate, but he heard the other animals still shuffling around, he considered that he might have gone blind. He’d been warned not to look into the sun before, and those lights above the table were pretty bright…

He was less worried about this thought than he should be but when an unexpected sound came from in front of him, his new eyelids snapped open.

Or rather, they dissolved. One moment, his eyes were covered with inky black, then the darkness dissipated slowly, and he found himself staring straight back at Dr. Dor.

She screamed, and jerked back. “Ty! Something’s wrong with the Bug!”

The other scientist came over, and she explained what she had seen, speaking too fast for Bog to follow, distracted as he was by the momentary darkness.

When, a moment later, a bright light shone into his cell, the darkness returned, just as fast, even though he could still feel the heat of the light on his skin.

He scrunched his nose against the darkness, and everything felt normal. The skin around his eyes always felt raw, and that hadn’t changed. But when he thought about blinking…

The darkness receded. Ty and Dor, on the other side of the bars, looked just as shocked as he felt.

But it was wonderful. If he thought about it, the stinging, unrelenting light would just go away. He didn’t understand how, or why, but it did. After three months with such a basic, fundamental choice taken from him, he reveled in playing with it.

He widened his eyes as far as they could go, and called the darkness. He squinted, and discovered he could banish the darkness only on a small bit of his eyes, as if he was really was squinting through his lashes.

Elsewhere, beyond his reclaimed private world, Ty and Dor were speaking, half-way to an argument, all the way to histrionics on Dor’s part. But for once he didn’t care. He spent a good three hours practicing with his new shades, discovering all he could about them, before he felt the sudden coldness of the bubble descend. Then he felt the familiar shift of sudden research - In and out of the bubble, one moment he was on the table, next back in the cage, so fast that he couldn’t blink his new eyes, before the true darkness finally descended.

-------------------------------------------

General, dear, you might want to stop by the laboratory. At your convenience, of course. Something of interest has occurred, and I believe you may wish to see for yourself.

You know I would not bother you with trifles. We will be placing the Bug in storage until you have a moment to grace us with your presence.

Devotedly, as always,

Dor DeWitte

------------------------------------------------

When reality returned, he felt as if a longer than usual amount of time had passed. Squinting at the lab, things were in different places, and there was a doubly array of coffee cups on the counter. Dor and Ty looked tired, both with deep circles below their eyes and hair escaping from buns and ponytails. They must have worked for days straight.

Roland, of course, looked perfect.

“Why did you call me here again?” His hand rested on the pommel of the sword, which Dor kept glancing at, while Ty did the explaining.

“You said to watch out for any of the creatures developing fields. The Bug has.”

Roland’s face snapped to Bog, and the boy did his best to smile through the bars.

“What? He doesn’t have wings!”

“No, no. Something more interesting. He re-grew his eyelids. But as fields.”

Clear excitement bubbled in Ty’s voice. Bog had never heard him sound so emotive about anything.

But Roland scoffed. “Eyelids? You brought me down here because it can blink?”

Dor spoke, “It is something small, yes. But we have been looking for any hint of further deviance. This is the first example of a change beyond the initial mutations. And it was to repair itself, rather than further the damaging mutation. This implies that there could be desire working on the mutations, as you yourself hypothesized.”

Bog was still reeling over the disappointed look Roland had shot his way, but he noted the calm way Dor spoke, so unlike her normal shrill whine.

“The creature has frequently demonstrated frustration and pain at prolonged exposure to light. This one, small, change, may greatly increase the creature’s quality of life.” Ty said.

Dor rolled her eyes. “If you care about that kind of thing. But Dr. Sakemoto is right. This could be a worrying advancement. How are we to keep the Twisted contained if they develop the ability to field like other Ascended creatures?”

“Hmm.” Roland tapped a finger on his sword. “Let me look at the creature alone.”

This time they left without question, and Roland strolled over to Bog.

He squatted to look at him, and Bog made sure to blink slowly so the knight could see what had changed.

Roland sighed. “I guess wings were a bit too hard for you.”

“But I guess I can understand. Those fields help you, even if they don’t help your mom. It must be real bright in here, huh?”

Guiltily, Bog nodded. He wished he could explain himself, say how hard he’d been trying to get wings for Roland. But the best he could do was slur a “Sss-sss.”

“I know you’re sorry, champ. We just gotta do better, okay? Dor said something about your bubble looking wrong, so I’m gonna make sure she keeps putting you in bubbles exactly like that one, and you focus on getting those wings.”

He nodded hard. How silly of him, to think that Roland would have been happy with this. The man had been very clear about what was needed to help his mom. Bog would just need to try harder.

----------------------------------------------

“General, we have a request to lift quarantine for Doctor Ebodia Dlamini of New York University. His expertise on - “

“No.”

“I’m sorry?”

“No. We’re not letting a single one of those filthy goblins out of those bubbles until we understand them.”

“But...there is an outbreak of - “

“This is more important.”

Chapter Text

Unfortunately “try harder” didn’t seem to be enough to control what abilities Bog came out of the bubble with. He felt guilty for a week, each time he blinked his new eyelids and chased the world away. Roland was working very hard to protect his family, and all Bog was doing was laying around waiting to be bubbled.

The darkness made it easier to picture wings, though. Big fluffy angel wings, soft and warm, like a blanket for when the cage got cold. Smooth iron wings, like the scalpels they used on the rats more often now, as the Experiment was beginning to move forward. Butterfly wings with shifting colors, crow wings of all black, shimmering crystal wings...they were all so much easier to picture when he could close his eyes to concentrate.

But instead he popped the catheter bubble the third month, and wet himself in the process. Then he grew a bigger barrier, pulled up instinctively when the rat screams got too loud and accidentally popped the cage-barrier in the process.

Roland didn’t visit after either of those incidents, but Dor and Ty didn’t seem to mind. If he could understand their words correctly, they had begun a experimental regime to definitively prove that the Twisted were not caused by a disease, nor further endangering their fellows with exposure. It was the first step before they could go on to test their wilder theories.

He hadn’t realized how repetitive “real” science was. The scientists seemed to repeat the same procedure on every rat, every time each one came out of a bubble, recording every possible thing about it before moving on to the next. Then the whole thing was repeated again, some of the rats the same, some of them new.

He was starting to understand the language, though, and that helped ease some of the boredom.

He found out more about Dor and Ty. Dor was married, and had a daughter. Ty was not, but didn’t seem to mind. Apparently, they both were something called “creature creators”, though they had rarely worked at the same place until now. Despite their disparate personalities, they really did get along well, and had known each other for years, even when they were working on opposite ends of the planet.

The only thing that they really disagreed about was the treatment of the specimens. Ty was the one who had suggested the balls, and spoke fondly of past projects in which he had worked with strange looking animals that were still very useful.

Dor was a specialist in correcting problems, rather than creating potential new ones. She’d been set on the path when her daughter had caught a virulent strain of genetically modified virus that left her mentally handicapped. Before then she’d mostly created made-to-order pets for very wealthy people. Now she worked heavily at the genetic level to remove illnesses and prevent disease.

She saw everything as a potential danger, while Ty saw endless possibilities. Perhaps that was why they worked together, though both would benefit from having a companion who sat between the two extremes.

That companion arrived after he spent a long stint in a bubble. It was impossible to tell time within them, and he’d once again been distracted from thinking of wings, so he didn’t notice that what had seemed like a few weeks for him had turned, in an instant, into several years for Ty and Dor, until he looked later and realized that they both had new lines on their faces and grey in their hair.

Then again, he might not have noticed time going by normally. By then he’d begun falling into an odd, thoughtless state through much of the day, what an adult might have called meditation but the boy considered his ‘zombie’ time. So he didn’t even notice when someone new arrived, until he heard Dor squeal with joy rather than disgust.

He opened an eye, only to find someone staring right at him.

He yelped, and did his best to back up, and the new face retreated as well, a bright smile on their face.

“They are as ugly as you say.” They said, turning to Dor and brushing off their coat.

“I know, right?” Dor responded, drawing the new person into a hug. “I’m so glad you’re joining us, Sam!”

“I agree.” Ty was also smiling, and held out a hand which ‘Sam’ caught and shook firmly. “Your expertise may be the key to this whole thing.”

“Hah! General Roland just had to say you had new fields popping up, and he knew I’d be over here as fast as I could be.”

As the scientists spoke, Bog tried to understand this new addition. They had short cropped hair, dyed bright green, and crystal pendants dangling from their ears. But what was strangest of all was their lab-coat.

When it had been just Ty and Dor, the color of their coats hadn’t been obvious. But they were tinted with a very pale beige. In comparison, Sam’s coat was tinted red, washed out enough to look pink.

This confused Bog, until halfway through the discussion, Sam waived a hand and half a dozen bubbles appeared in the air, shading from pure white to black.

Ty and Dor had never done anything like that. They made the machines do all the bubbling. But this new person was an expert in bubbles.

And far more than that, as Bog found, when they pulled him onto a table and spent hours examining his new eyelids, lightly tapping at them and taking all kinds of readings with devices Bog had never seen before.

Whatever they found made them smile all the more, and the day ended with the three scientists chatting excitedly as they left the room.

Dr. Sam, it turned out, was a “fielder”. A specialist in bubbles, but also in the things that were not-quite bubbles, like Bog’s eyelids and the barrier that protected the cages. What this meant for the experiments was far fewer vivisections, and more bubbling rats.

Bog could follow enough of the scientists’ conversation to guess at the logic. They had noticed that the bubble that he’d been placed in before he’d gotten his eyelids was different somehow. Obviously, Ty and Dor could not replicate the fault intentionally, but Dr. Sam was experimenting to see if they could. They had some success, just based on the initial readings from Bog’s bubble, along with what little information they had from Roland’s initial searching for the twisted creatures that shared the cages.

“It’s almost like a bubble that one of the Old Families would make.” Sam said one day, examining a bubble that was not all black or all white, but rather a swirling mix of the two.

“How do you mean?” Ty asked, and Bog listened close, feeling far more confident in his understanding of the language after a full five months with little to do but study it.

Sam leaned back, examining their work critically. “There’s a rumor around the Repository that some people have bubbled themselves, rather than let the techs do it.”

“Didn’t Jubal Herschal do that?” Bog’s eyes widened. Everyone knew of Jubal. He was the creator of bubbles. Apparently that name at least had passed on down to the future.

“Don’t be crazy, Ty!” Dor said.

“No, he’s right. First storage bubble. Jubal Herschal mailed himself to Mars, to escape Earth.” Sam said. Bog remembered the story - the man had been some kind of super-genius, and the governments of the world had locked him away from his friends to make more bubble-gadgets. When it got too much, the poor man had invented a totally new kind of bubble, just to get away and back to his friends on Mars.

“So maybe it’s not a surprise that some of his descendants have the ability to bubble themselves.” Ty said, while Dor shuddered at the thought.

“Hadn’t thought about it that way. I suppose you’re right. Wouldn’t have wanted to be the first one to try, though.” Sam said, shaking their head. “But people come out of those bubbles just fine. What would protect them, while these ELF creatures end up so twisted?”

“I suppose that’s our job to figure out, isn’t it?”

------------------------------------------

“How many more scientists do you need?”

“A full team of fielders, and some more geneticists.”

“It was one thing to snap up DeWitte and Sakemoto, Roland. They wouldn’t have been allowed to work anywhere else for at least a century. But Sam D’Plume? Caelen Boward? People will notice if they’re gone.”

“You know my feelings on the secrecy of this matter, Director.”

“And the stars-be-damned government does not agree.”

“Only because of you.”

“You’re damn right. You might be able to tug the wool over Pierre’s eyes, but I’m as much of a scientist as you, General.. A couple dozen cases does not an outbreak make. You’ve yet to prove to me that this is a real problem, and not some bad filing. You get your team of a hundred when you can prove that these ‘twisted’ didn’t go into their bubbles like that and that their disease is in any way transmittable.”

“Fine. But are you sure you’re willing to risk a bubbling in the meantime? …I didn’t think so, sir.”

-----------------------------------------------

Bog had nightmares about the first few rats that were put into the altered bubbles. He had thought the vivisections were bad enough. But those had mostly been to establish a baseline. Now that they had an idea about what had caused the mutations, they turned the bubbles onto the rats.

The fact that Sam didn’t lose their lunch at the first batch of experiments showed just how much stronger the scientists were than Bog. They looked at the little creatures, who had been variously crushed, rapidly aged, imploded, scrambled, or worse, and simply sighed at a failed experiment.

Bog lost his lunch, but none of the scientists noticed, as Sam adjusted a device and a new set of rats were fed into bubbles.

Wrong! His young mind screamed, as the little creatures went to their fate. He’d been raised in New York, so he had no love for rats or mice, but the completely uncaring attitude displayed by the scientists was starting to bother him. It was bad enough the way they treated him, but this was getting excessive.

Over the next four months, Bog watched as thousands upon thousands of rats were sacrificed to the fickle “twisted” bubbles. As the experiment progressed, more scientists joined the team, growing from just two, to three, then to five and all the way up to eight. The rooms were changed, becoming even larger and louder, but the treatment of the animals did not improve, and they moved on to more complex animals than rats, before they seemed to fully grasp why they were seeing the results they were.

Ten months in, the scientists found themselves unable to easily control the new bubbles. They popped easily, sometimes randomly, releasing rats and rabbits and monkeys back into cages before any change could be observed. There was no logic to it, and the whole experiment ground to a halt, so much so that someone - probably Dor - called Roland to complain.

It was odd to see him have the same effect on a room of a dozen scientists that he had on just two. He strode in, hands in his own, deep blue, lab-coat, and everyone stopped, watching him with equal awe and nerves.

Dor rushed over, and there was a hurried conversation, which included at least one look of complete confusion from the scientist, before she gestured to an assistant and without warning Bog felt a bubble descend.

When he came to, he wasn’t in a cage, but rather sitting up on an examination table, in what looked like a doctor's office, if he ignored the prickle of field-restraints on his skin.

Roland was sitting on a chair opposite him, twirling a lock of his perfect hair.

“You haven’t been back in a bubble for two months.”

Bog flinched. It was true. Since the change to the new space, the twisted animals had largely been set aside, presumably for later study and to be available for any new scientist to see.

Roland sighed. “I suppose I can’t expect you to get wings without the bubbles. But that doesn’t mean you get to back out of the rest of our deal.”

“???” Bog looked up hurriedly.

“Don’t cause trouble? Did you forget that bit?”

Bog was still confused. Despite the boredom and the lost lunches, he had been trying to be very good, no matter how much the new scientists poked and prodded him.

Roland searched his face, then barked a laugh. “You have no idea, do you?”

The boy shook his head.

“You’ve been popping the bubbles. To get my attention, was that it? You know I’m happy to visit, any time you get results, but you’ve taken me away from some very important work.”

“Buh-buh... “

“I know you’re sorry. And I’ll promise to visit more, if you stop popping those bubbles. Sam and their scientists are working very hard to understand what is wrong with you and the rest. You need to let them work, or we won’t be able to help your parents.”

Bog’s face fell, pulling taught the corners of his face enough to burn. He needed to protect his mum. He knew that. But what they were doing to the animals...that was wrong.

It wasn’t that he didn’t know what animal testing was. His mum had explained it once, reading out from one of the science magazines she got for him, about how experiments on mice and other animals happened so they could be sure things were safe for humans.

He remembered those cages. They were burned in his memory now, thanks to his experience behind his own bars, fighting through hazy memory to best understand his own situation. His mum had talked about how all the animals were taken care of, kept happy and healthy as much as possible, not for their own benefit, but to get the best possible data for the experiments. It hadn’t been something nice, but he understood that it had been necessary with the primitive technology available to Earth at the time.

But the animals around him weren’t kept happy for the sake of the best data. They were miserable. Bored. Often in pain. And at the end of their lives, they were subjected to even more brutal treatment, rather than being terminated quickly and painlessly.

If he could, Bog would have taken the place of any one of the mice. He was the one who was messed up, after all. In a way, this was all for his benefit.

Guilt pulled at his gut, and he suddenly felt sick. Even if he hadn’t known it was him...he’d wanted to pop the bubbles. To protect the mice, and rats, and rabbits and monkeys. He’d wanted so bad to protect them from the ugly, twisted bubbles Dr. Sam made. So no one else was hurt the way he had been.

And in doing so, even if he hadn’t realized it, he’d just prolonged the danger to his parents and all the other humans.

“Jeeze, grown men don’t cry, little cockroach.”

He tried to blink away the tears, but his new field-lids didn’t work that way, and his eyes still swam.

“It’s all right. I understand you want to do everything you can to help your parents. It must be hard watching stupid animals get what you need.” Barely listening, Bog nodded along to Roland’s words. There was no point in disagreeing with him. “I’m going to make sure they bubble you up between rounds of experiments. That way you can focus on your job, and keep everyone protected from you, okay?”

The boy blinked, the words trickling through the wider pain.

The scientists needed to be protected from him?

The thought wormed its way into Bog’s mind, even as Roland did the unthinkable and picked him up.

It had been almost five months since Ty had touched him, and this time there was no pain or terror. Just strong, warm hands that transferred him to an elbow, allowing Bog to rest his head on Roland’s shoulder.

He fought not to cry and endanger Roland’s clothes, but it was hard. He knew Roland hated the sight of him, and that he’d only disappointed the man, over and over again.

To do something so kind, for someone so undeserving, won Bog’s loyalty all over again.

He was glad he didn’t bleed all over Roland’s clothes. He was proud when Roland reminded the scientists of the importance of their work, speaking in such a way as to include the animals’ sacrifices without ever directly referencing it. And he was more determined than ever to get wings, and make Roland proud.

--------------------------------------------

So what do you think of this new video, Galina?

Frankly, Clive, I don't see why we're discussing it at all.

Oh come now. You've got to admit its pretty convincing. And it certainly explains all those new gene-mod regulations, doesn't it?

Right. And explains why the government has been more restrictive with fielding and Awakenings. All these weird coincidences, explained away in one neat little 10 second vid.

Do I hear some skepticism?

Ya think? Its too neat. 'Oh, look at this horrible ugly monster than used to be a person. Best not push the envelope or you might end up like that'.

That's pretty much exactly what I was thinking, yes.

And who does that benefit, huh? Even if the video is 100% true - and I am far from convinced - whoever released it wants us to be scared.

Well, it certainly worked for me.

So what are you going to do? Stop experimenting with your fields? Give up gene-mod? Never use bubble-travel? You might as well just run back to Earth, if you're going to abandon all the things that make us truly Martin.

When you put it that way...

And you can bet the military is still experimenting with fields and gene-mod, and gets whoever they want out of the Repository. Then it starts sounding more like an excuse for a power-grab than an actual disease.

Now who's the conspiracy theorist?

Hey, I'm just calling it like I see it. I'd much rather be out there flaunting my wings like the King, than holed up in some industrial bunker trying to stand in the way of progress.

Unfortunately, only a third of Mars agrees with you. I imagine we're going to see more changes after this, rather than less.

Good fucking luck with that, man.

Chapter Text

He did his best over the next month, keeping to the back of the cage, away from the lights and sounds of the lab, only emerging whenever any of his companion animals were taken for tests and he had the chance of getting into a bubble. He wanted to prove to himself, as much as the scientists, that he wasn’t as dangerous as Roland had suggested.

Unfortunately, the scientists seemingly had found a new avenue for research, and as such were mostly ignoring the specimens. Nothing at all happened, and he found himself drifting into the ‘zombie’ space more and more often...

And then she arrived.

------------------------------------------------

By then, he’d parsed the different lab coat colors into a bit of a code. Red - the color of Mars - was for Field Researchers. Green - the color of Earth - was for animal scientists, like Dor and Ty.

There was a third color that very few people wore. Blue. He wasn’t sure what that meant, except it was the color that Roland wore whenever he visited if he needed a lab coat.

That changed when a woman coated in bright, sparkling blue slammed open the door to the laboratory.

Her blonde hair was tied up in a style that defied gravity, and she was carrying three bottles of wine precariously held by their necks along with as many wine glasses as she could in the other hand.

“Neighbors!” She called out. “Come join the party!”

“Mum!” Dr. Sam complained, hurrying over to retrieve some of the glasses. “You can’t be here!”

The new woman laughed. “Please. I have every clearance to be here. You might not be able to come into our lab, but that’s why we’re throwing the party in the hall!”

“Mirabelle.” Dor hissed, descending upon the two. “You are interrupting our work.”

Shocking Bog further, Dr. Mirabelle laughed in Dor’s face. “Not much work, if I’ve heard right. C’mon. Maybe celebrating our success will be just the thing to turn on some light-bulbs for you lot.”

Not taking no for an answer, she pulled out a cork with her teeth and filled three glasses at once, much to Dor’s clear frustration.

After the first sip, she looked around at the motionless scientists.

“Well? Do I have to turn this room off to get you guys to have some fun?”

“No, don’t - “ Sam started, but Mirabelle waived a hand, and suddenly every machine in the room went dead, and the lights flickered to their lowest setting.

“There. Everything’s off until I see every one of you at the party. No buts! It’s time to Cel-i-brate!”

Half the room was already shuffling towards the door, attempting to look nonchalant in front of Dor, but when the elder scientist finally relented there was a rush outside, huge grins cracking the faces of the scientists and cheers and shouts of congratulations to whatever team was already in the corridor.

Dr. Ty and Dr. Mirabelle were the last to leave, the male scientist taking a glass and the other’s arm.

Bog strained to hear the man’s words.

“So it’s worked? The PLUM project?”

“Oh, it's done far more than that, Ty. Its opened possibilities for us that we’ve never even dreamed of.”

-----------------------------------------

Dr. Mirabelle’s last name was Illia De Plume. Bog found that out when she and Ty wandered back in hours later, still chatting like old friends. She waved at the door, and it responded to her as easily as any of the other scientists, clearly someone with more power than Ty or Dor. Maybe someone as powerful as Roland himself.

Maybe that was why their coats were the same.

“And this is your research?”

Ty was sipping a drink from a funny-shaped glass. It had a tiny bubble in its base, and was mostly closed at the top. It became apparent why, when he placed it beside him, and it hung in mid-air, tumbling slightly but not losing a drop.

“I suppose there’s no point in keeping anything from you?”

She shook her head, grin leaving laugh lines around her mouth and eyes. “I’ll just find out anyway.”

“We’ve been studying irregular bubbles. And the creatures that result from them.”

“Oh! Fascinating!” She said, and scooted off the table she’d been sitting on to come and inspect the cages.

Bog quickly backed up, trying not to disturb her, but just like her child she immediately looked at him with curiosity, but none of the disgust he was so familiar with.

She examined his face, and asked, “Can it understand us?”

“There’s been no indication that it can. All initial scans came up normal for its creature-type, according to Roland.”

Mirabelle cocked her head to the side, still examining Bog. It made him uncomfortable to be under such intense scrutiny. Most people couldn’t stand the sight of him, so their eyes slid away each time they were unfortunate to catch sight of him. This woman didn’t look away, and in some ways that was worse, because he knew what he must look like to her, and wanted to think of that just as little as the scientists did.

“Does he act like a dog?”

Ty shrugged. “That’s not really part of the research.”

“Hmpf. You might do better if you looked for things outside your parameters. That might explain why you’re all so terrified of a silly dog.”

“We’re not scared!” Ty complained.

“Tell that to Sam. They swear the thing is intentionally sabotaging the experiment.”

Bog’s eyes darted away from the woman’s, feeling guilty, and she made a thoughtful hum.

“Have you considered hooking it up to AR?”

“Why would a dog need AR, Dr. Illia?”

The strange, flamboyant scientist looked back at Bog, though he’d crawled as far back into his cage as he could.

“...why not, Dr. Sakemoto? It might help your experiments more than you think.”

Chapter Text

The day after the party, Bog accidentally burst a half-dozen bubbles. Three of the hung-over scientists got into a screaming match, and somehow the rest were all drawn into it, culminating with Ty and Dor in a heated argument over the cause of the problems.

The two had never fought before in Bog’s presence, and it was only worse when Dor pointed him out as the problem.

“That thing is getting in the way. Even if it isn’t directly causing the bursts, it disturbs everyone.”

“Roland was very clear - “

“Roland was clear that it should be studied. You are the one that thinks it’s fine to keep the ugly cockroach out in the light where it can hurt people.”

“And you say it’s too stupid to field, while at the same time saying it causes every problem in this lab. Perhaps if we - “

“No. Whatever you’re about to suggest, no. That thing doesn’t deserve it. We’re bubbling it up, just like Roland said, and not letting out until it can’t ruin everything.”

The blond scientist waived a hand, and the darkness descended, even as Bog was admitting himself that everything Dor said was true.

He was a danger. He did cause problems. As Roland had said…

They needed to be protected from him.

------------------------------------------------------------------

“Sir?”

“Dor. I thought I told you never to call me directly.”

“There is a situation.”

“One that couldn’t wait until morning to solve?”

“We can’t get the Bug out of its bubble.”

“WHAT?!”

---------------------------------------------------

“Explain this to me again.”

The lab was empty, except for the lead three scientists and Roland. All four stared at the inky black bubble on the table.

Sam wiped at their brow.

“I’ve never seen anything like this before. But perhaps we should have anticipated it. The Bug specimen is the only creature to have developed multiple field abilities. It seems best at breaking fields, but this...I believe it has reinforced its bubble in some way.”

Ty stood with his arms crossed, leaning on one of the tables. “There are rumors that some of the Old Families can do something similar.”

“Not quite.” Sam said, leaning forward to look closer at the bubble. “There are some with the ability to bubble themselves, but they encode Awakening conditions into the ‘net. It would be incredibly dangerous, and no one has chanced it without a ‘net connection that only an Old Family could buy.”

“Of course, only someone as mad as them would ever consider it.” Dor said.

Sam shot her a look. “The Old Families push the boundaries with their fielding. Mars has benefited greatly from their curiosity.”

“They’ll all come crying to us if they end up looking like that, though.” The geneticist said, jerking her chin towards the bubble.

“Enough.” Roland interrupted the brewing argument. “You’ve both proven your point. This is somehow different than what those with Wings have access to.”

“Correct, sir.” Sam said. “Best I can describe it is a double-bubble. My team has hypothesized that while the first bubble was going up, the creature created a second bubble with the same instructions.”

“What do you want us to do?” Dor asked. “If we can’t access it, then we might as well get rid of it, right?”

“No.”

“But it’s such an ugly thing anyways. Why bother with - “

“No. I think I can get it out.”

The three scientists exchanged another glance.

“Not to doubt you, sir, but how?” Ty finally asked.

Roland chuckled. “This isn’t the only classified project I’m involved with, you know. And we’re damn lucky that the other one has been a mite more successful than you lot.”

------------------------------------------------

He didn’t want to go back. The lights. The screams. He could have dealt with all of that. But he would not be responsible for more people being hurt. If that meant never seeing the light again, he would accept that.

He was not given the choice.

Searing pain brought him back to the real world, surrounded by the familiar faces of the scientists, wreathed by the familiar tickle of restraints.

His eyelids were gone, and there was a dull, pounding pain in the part of his brain that he called upon when he wished to blink. But that was just a minor pain, compared to the pounding headache at the top of his skull and the searing pain along his back. It felt as if acid was etching its way through every crack in his skin, and had he a voice it would have been screaming itself raw.

Instead, he fought back the tears as he always did, and a moment later someone - Ty, he thought - was pressing a blanket on him that removed the searing sensation.

It was the first soft thing he’d felt in almost a year.

“The liquid worked!” One scientist said.

“Of course it did. General Roland said it would.” Another responded.

“Still. This is amazing. Does it really dissolve any field it comes in contact with?”

“Quiet, you two.” Sam spoke out, Bog just catching sight of their red coat from the corner of his eye. “Send the PLUM team our results on the Bug bubble.”

“I can’t believe they just gave over all their hard work.” One of the scientists added, their hands flickering in the motions Bog had become familiar with as interfacing with the ‘net.

“They need fields to test on. We just happen to be generating non-standard fields with our work. It’s a good match up.” Sam explained.

“And they will continue providing the acid, as long as we continue to send them reports on its effectiveness.” Ty added. “So make sure you are detailed, Chen. Not another of your slap-dash babbling. They need as much information as we can provide.”

“Yeah, yeah. Don’t get your kimono all in a twist.” A new face loomed large in Bog’s vision. “But this really is an ugly thing, isn’t it? Are you sure this caused the reinforced field?”

Ty sighed, and Bog winced internally at giving the man more work to do. “We can’t discount any possibility yet. Run all the tests you can think of, and make sure to put it in a normal bubble for transport. Don’t let it escape again.”

Chapter Text

Things changed after the bubble mistake, which Bog was grateful for. The less time he spent around the other experiments, the less likely he was to accidentally interfere. It also gave him more of an opportunity to uphold his end of the bargain.

He couldn’t understand the pain from when he was pulled from the bubble, but Roland informed him he’d done something very dangerous when he stopped by the lab a few weeks later for an inspection.

It was strange how Roland spoke, leaning against the cages and hiding the movement of his mouth but making no motion to hide his voice. Somehow, the scientists didn’t notice his words.

More internet magic, Bog guessed, and did his best to follow instructions. Roland had taken time out of his busy schedule to visit the lab just for Bog, and the boy swelled with pride at the thought, even as Roland spent far more time speaking with the scientists discussing some new device that needed to be kept classified.

After Roland left, a new routine was established.

Instead of days upon days spent bored out of his mind, Bog spend more time in bubbles, only coming out when scientists needed new samples.

There was still a lot of failure. Even as the scientists refined their bubbles, and Bog tried his very hardest to concentrate on wings wings wings.

One day, he came out having sliced his arms and legs free, just because he’d been itching before he’d been placed in the bubble.

He spent the next month out of the bubble, arms and legs wrapped tightly together, completely unable to move, barely able to squirm to his food trough and the itch magnified a hundredfold as his skin melded back together.

Another time, he heard something from inside his bubble, a scream of pain on the same frequency as his own, and popped both himself and one of the experimental rabbits out of their bubbles. The rabbit’s foot had been cut off while going into the bubble, and its pain had somehow reached him in the other-space.

But most of the time, nothing changed, no matter how hard he concentrated on making wings.

And while he worked, and failed, time sped by around him. Each time he was awoken, little things had changed. Sometimes there were new scientists, or new machines, like the huge purple window that Dr. Sam had developed with their mother that allowed even more precise manipulation of bubble fields through an interface with the ‘net.

Bog made a bit of a game of it, trying to guess how long he’d been in a bubble based on the little changes, cataloging everything in the lab and trying to memorize exact locations and movement patterns to help him guess if months or years had gone by.

The Martins were no help when it came to guessing time. Age didn’t show on their faces in the same way it did on ELFs. He knew he’d been in the lab for at least ten years - Dr. Maribelle had forced another party on the staff for it and all the specimens had been brought out as a kind of living reminder of the importance of the work - but most of the Martians looked no different from the first moment he’d seen them to the most recent.

Not so with Dor and Ty, though. As the years passed age etched its way into their face, not through lack of youth supplements, or whatever kept Martins young, but the stress and worry of the project. Each time Bog came out of his bubble, he knew there had been little real success on the project, because he still didn’t have wings.

It was a shock when he was brought out to be introduced to a new batch of scientists, and some of them had the wings he coveted.

Of course all of them were older than him, but the two with wings were the youngest scientists in the team.

Bog marveled at them, and couldn’t help but pop his bubbles for a few weeks just so he could keep the two under observation.

One, Mataias, was a fielder. The other, Marsha, wore the blue coat of what Bog had finally realized was a for mechanical technicians.

Marsha had a pale, wispy yellow cloud that hung around her shoulders, that was sometimes hard to see against her vibrant blue coat. Her 'wings' weren’t as transparent as the force fields Bog was familiar with, but it didn’t seem to do anything other than occasionally knock things off tables behind her, causing the shy woman to flush and apologize profusely.

Mataias had a deeper colored cloud, shading closer to blue, and seemed better able to control it as well. He cinched the cloud tight when anyone walked behind him, and occasionally emphasized a gesture by allowing the dark mass to mirror the motion.

It was obvious the cramped conditions of the lab were uncomfortable for both new scientists, but most of the younger scientists completely ignored the strange fields growing from their colleagues backs, treating them exactly the same as the other two new additions.

The older scientists, Ty and Dor included, were not so comfortable with the strange appendages. Bog even caught Dor glancing at Marsha’s back with the same disgust she usually reserved for him. Ty simply didn’t know how to interact without becoming distracted.

In comparison, Sam was full of endless questions, which both young scientists waved off with no explanations. Clearly, having wings was as a surprise to them as it was to the rest of the scientists. From what Bog could understand, it just happened sometimes. Some Martins had wings, appearing randomly sometime in their teens. And that was the best explanation they could give.

Now with a better idea of what the wings Roland wanted looked like, Bog went back to his bubbles with a renewed determination. He just wished he knew what the wings were for.

He was brought out for the fifteen year anniversary, and then the twenty fifth, and neither he nor they had made any progress. More new faces appeared, and now most of the younger set had wings. Marsha and Mataias became mentors of a sort to the younger scientists, but even some of the older ones developed wings. Bog tried not to hate himself for his failure when he saw Sam proudly displaying their bright blue cloud, stronger even than Mataias.

He listened close while they shot out guess after guess as to why they had developed wings, even so late in life, positing that it was because of their experience with fields, and encouraging everyone within earshot to take a sabbatical to try and get wings of their own.

“And risk ending up like that?” Dor had said, jerking her chin in Bog’s direction, and immediately the thoughtful consideration from the older scientists evaporated.

Really. Who would want to look like him? No super-powers could be worth the risk.

-------------------------------------------------

Fifty years into the program, the scientists had made some progress in understanding the Twisted bubbles. A certain fault, incredibly rare among the normal bubbles, but able to be replicated more or less consistently in the controlled environment of the lab, allowed them to create mutated creatures about half of the time subjects were put into bubbles.

Sam, now with light lines around their eyes and lips, making them look like a twin of the strange woman who occasionally blew like a whirlwind through the lab, had taken over most of the experiments that Bog participated in. With the addition of wings, they had been able to create stranger and stranger bubbles, and Bog was often the first test subject they chose.

Perhaps it was a side-effect of being the worst twisted that existed, but Bog found himself near indestructible. No matter how he tried to be good, he instinctively popped any bubble that felt wrong. Rather than rage at that fact, like Dor did, Sam used it. They shoved Bog into every new bubble, and if he didn’t immediately break free they left him in it while they ran new experiments.

Around the fifty year mark was also when he made his first friend.

Sam had been experimenting with a different kind of bubble, one that overlapped with their mother’s work in some way Bog couldn’t understand, but had resulted in dozens of blue-coats invading the lab, enough that Roland himself had to be summoned to quiet Dor down.

When they moved up to testing organics, Bog was the first to experience the strange, blue-colored bubble, but by then he’d gotten so good at pretending to be a zombie that he barely registered Sam’s call for his participation, simply starting up the mantra of wings wings wings before the darkness descended.

And, as always, he welcomed the freedom of the darkness with relief, content to be gone for however long before they needed him again.

“You’re not supposed to be here!”

The voice passed through him, just like every other sensation in the other-space, but somehow enough of it stuck that his sluggish brain refused to let him sleep.

But it was the same darkness as ever. He didn’t have eyes to see, or limbs to move, or thoughts to think.

Yet…

“Humans can’t exist here. So what are you doing?”

The voice was high, and grating, and somehow everywhere - and everywhen - at once.

“You! Yes, you! I know you can hear me!”

Leave me alone. Bog thought. Let me go back to sleep.

“Nuh-uh! You’re the only one who I can talk to! Wake up!”

The voice spoke. And the idea that someone was speaking to him sent a burst of adrenaline through Bog enough to wake him fully.

...who....?

He still couldn’t see anything, but he could feel that this was not a normal bubble-space. If he concentrated, he could feel his heart beat, meaning time had not completely stopped as it should. Things could happen here.

“I’m the Sugar Plum Fairy!”

“WHAT?!”

“Oh! You’re up! Finally!”

There was no point in looking around, but Bog tried to anyways. The darkness seemed...warmer, somehow. And it was undoubtedly occupied. With what, he wasn’t sure, but for the first time he wasn’t alone.

He tried to speak, and it didn’t work. He tried to move, and that didn’t work either. But when he did, he felt something. As if he was being pressed on all sides. It wasn’t uncomfortable, and he felt no need to breath so he didn’t panic, but there was certainly something there.

“You must be Bug.” The voice chattered on, oblivious to his shifting. “I see what happened. They sent you to my dimension. Now why would they do that? This isn’t made for humans.”

It's an experiment. He thought back. Just a test.

“Well, tell them not to do it again. There’s no point. I can talk to you far easier through the ‘net.”

What...what are you?

“I told you. I’m PLUM! I look over all the other-net systems of Mars, and stop them going nuts. And now they’re being put into this dimension...which is how I found you. How long have you been here?”

Bog tried to shrug, and the thought must have been conveyed, because Plum hummed.

“You’re no use. Lets see what you’re records say...Oh! You’ve been here longer than even I have. They used you to test if the dimension was safe...and you’ve been what, asleep for the last fifteen years while they piled everything in with you?”

Another shrug. Why can you understand me?

“You’re neck-deep in bio-organic computer systems. I’m interfacing directly with your brain. You’re lucky you don’t have an AR hookup, or you’d probably have gone insane.”

Maybe I’m already crazy.

“Nope. Not according to the Martin Diagnostic and Statistical Manual of Human and Near-Human Mental Disorders: DSHM 15, 15th Edition, Martin Psychiatric Association, 549 ae. Way easier to understand than Mushrooms, that’s for sure. But...geeze, no wonder you ended up here. Your lab sucks. Do you have anything to do in that cage?”

I have work. For Roland.

“Ooooh, General Roland? He’s written into my core programming. Wrote in a special back door and everything. Isn’t that romantic?”

Everyone likes him.

“Of course! He’s perfect, according to the code. He gets all the highest security clearances. But enough about him.” Bog would have blinked, had he eyes. No one just stopped talking about Roland. But this Plum thing did. Maybe he really was going insane. “What about you? You’re what, seven?”

Don’t know. Bubble-time doesn’t count, right?

“You certainly don’t age in most bubbles. Lets see if I can figure it out…” Plum stopped speaking, and Bog felt time begin to drift away again. Without any other sensations, it was impossible to tell how much time had passed when the AIs voice broke through again. “...yup! Exactly seven years old, as of today! Well, as of the day you went into my dimension. Did you honestly spend a year doing nothing?”

I worked.

“On what?”

Getting wings.

“Martin wings? I suppose fielding is what a lot of your team is focused on...but you’re not a Martin. You haven’t had any of the gene-mod that helps you sense fields. Why would you be able to get wings?”

Roland said to.

“...oh. Well if it was a directive from him, I guess I should help you out, huh.”

Bog’s eyes widened, almost enough for his mind to create an after-image of a glowing blue ghost, standing right in front of him, smiling.

It was impossible, but just the thought made his heart clench. He knew the scientists were all working towards the same goal, but to have someone say that they would help made him feel as if a weight was lifted from his shoulders.

“And the first thing you’ll need to do that, is to stop thinking about it so much! Honestly! How are you going to be able to reach the upper dimensions if you feel itchy all the time? Let’s get you back into a twisted bubble, and make you feel better first!”

The real darkness came back, then, but it was a familiar darkness. One he hadn’t felt in ages, but that felt like home none the less.

It was just like his first bubble.

------------------------------------------------------

The first time, he’d been terrified. Later, looking at what he’d become, he understood why. But going back, chancing the change once again, was a relief. He’d become the worst possible thing. Whatever came next could only be better.

And, just as the last time, when he felt reality rush back, part of him screamed that it wasn’t enough. He wasn’t done yet. There was more to do.

But this time, he could breath.

He expected the scream, when it came. He even recognized it. Of course, Dr. Dor would have that reaction.

He blinked, and felt flesh scrape against his eyes and nearly wept from relief at the sensation.

The light in the lab was bright as ever. The silhouetted faces were familiar, all geneticists and none of the fielders, as was usual when he was pulled out of a bubble.

Dor and Ty had some extra lines around their eyes, but Ty was grinning wide.

“It worked!” He said, and clapped the back of another scientists. “Run the records on what was the last bubble it was put into.”

“Its worse!” Dor complained.

Normally, that would have stung. But when Bog shifted, he could feel his limbs moving.

He had arms and legs again. What ever Plum had done, it had worked.

Chapter Text

“You know, in twelve Sols it will be the hundredth anniversary of the Martian Crown. Shouldn’t we do something to celebrate? Something big?”

“Our cities are crumbling, love. There are rumors of bubbles turning people into monsters. People are frightened, in a way they haven't been hundreds of Earth years. Isn’t that more important?”

“Isn’t that when humanity has always needed the biggest dreams? When things are getting scary?”

“Louise…”

“No, listen. There’s a project I heard about. Something one of your crazies at the royal institute thought up."

“The overnet isn’t - “

“No, no. Not that. There’s a theory that we could restart the core.”

“What?!”

“It’s been a theory for centuries. When I was in school…well whenever the theory floated it was all about nuking it back into motion. Now though…”

“They’d do it with bubbles?”

“Yes.”

“Those mad men.”

“I’ve seen the science. They’re sure it would work.”

“But the cost…”

“Wouldn’t it be worth it? If we could walk outside a shadow and breathe again?”

“It would be hard to get past the Council. And the science would have to be perfect.”

“But?”

“...but you’re right. That sounds like just what our people need. Something to remind them what being Martian means .”

------

Dor wasn’t completely wrong, when she said Bog was 'worse'.

When Bog examined himself in his cage he found that the thick, leathery skin that had covered his body had hardened into plates, covering him in a strange kind of armor. Said armor was a good five sizes too big, forcing him to hunch and curl, to look out at the world through a turtle-shell of his own shoulders. But the skin between the plates was flexible, allowing him to move his arms and legs away from his body, even if he hadn’t regained anything like his full range of motion.

For the first time since he’d awoken, he could touch his own face without pain. He could blink real eyelids, and stretch the webbing between his fingers such that he could touch pinky to thumb, ring to pointer, and all to the still dough-like flesh of his face and odd, hardened points of his scalp. Nothing bled when he shifted, and that alone was a wonder, even as he spent a whole week simply re-discovering himself, marveling at his ability to merely touch his own face with his hand.

For once, he wasn’t ashamed of playing with the ball for hours, re-learning how to move and stretch, finally able to interact with the world in a way he was familiar with. He picked up the bowl from the floor, magnet having long ago lost its charge, and could eat with his hands - hiding in the back of the cage so as not to alert the scientists to any strange behavior, but reveling in feeling just that little bit more human.

It nearly made up for the fact that the scientists had taken his change and decided to chase off on an incorrect theory. There was a carnage of mice and rats in the following weeks, as the creatures did not find the other-space nearly as benign as he had.

But he was distracted from his worry about the other animals by another new thing.

Two days after he was pulled out of the bubble, he found a canister in his daily meal. He heard the thunk of it hitting the metal bowl, and the completely unexpected sound brought him away from the ball to the front of the cage, only to find the familiar dispenser-machine pausing in front of him.

The mechanical limb had never done anything like that, and he stared at it for a good thirty seconds before it made an irritated beeping sound. Quickly, Bog looked down, only to find a weird tube in his food.

Another beep prompted him to pull the tube out, and found it to look a lot like his mother’s can of hairspray. It worked just the same, when he pressed as best he could with a hand, a thin spray of something released from the nozzle.

A second later he heard something other than the normal lab sounds or the machine beeping.

“...y your face you dummy! Your face.” The words were distant, half-heard with the same thing he felt react when he blinked his other-eyes or popped bubbles, but it was there.

And, as dumb as it was to obey a not-real voice that probably was all in his head...he maneuvered the spray as best he could, and aimed it toward his face.

A bright blue form materialized right in front of him, and he dropped the canister with a clatter, not thinking to scream because he hadn’t been able to speak in over a year.

“Bog! Finally! Do you know how long I’ve waited?”

“...Plum?” His hand clapped over his mouth, but he hadn’t spoken aloud. Instead, he’d heard his voice in his head, while not speaking.

“Who else, you dummy? You know, we are literally right next to each other, in physical space? I looked all over for you, hacked into who knows how many systems, only to find you’re just the next lab over! We’re basically neighbors!”

Bog pushed himself into the back of his cage, and cautiously thought-spoke to the AI.

“You’re Dr. Illia’s AI?”

“You know mom?! What am I saying, of course you do! She’s probably the only one who talks to you. She’s the only one who talks to me.”

“Shouldn’t you know about me already? ‘Cus Dr. Sam uses you on their field research?”

The floating sprite placed an insubstantial hand on her chin. “Mmm. Part of me knows, I guess. But that part can’t talk to the rest, because it’s classified. If the main-me looks into it, I can find it, but mini-me can’t send the information out unless it’s requested. Does that make sense?”

“....not really, no.”

Plum laughed, and Bog felt himself smiling back at her, even if smiling hurt a bit when it stretched the corners of his mouth.

“Oh, I’ve got so much to show you, Boggy! We might both be stuck here in the real world, but now you’ve got access to AR. I’m going to show you everything!”

---------------------------------------------------------

“Sam?”

“Yes, mum?”

“Do you think AI can get...distracted?”

Sam laughed, and poured a refill of tea in their mother’s cup. “You’re the AR guru, mum. You tell me.”

Mirabelle leaned back in her chair, cup warming her frail hands. She really should remember to book a rejuvenation treatment soon. But there was so much work to do with the PLUM program.

“I ask because I don’t know.”

Sam sighed, and dumped cream into their cup. “Fine. Why wouldn’t an AI get distracted? From what you’ve said, PLUM is built upon dozens of subroutines that don’t necessarily work in a way a human can predict. If one of those subroutines got interested in something...could it pull attention from other work you’ve assigned? Like…” They considered and came up with an easy paradox, “Like if someone asked it to calculate the last digit of pi. All its processing power would go to figuring out that, and that would look pretty ‘distracted’ from the outside, right?”

Mirabelle considered, a grin widening on her face. “Hah. I should have known to ask you earlier.”

“I am your favorite genius. But I’ve got a question right back for you. We’ve been throwing all our over-net machines into the Nth dimension. They’re bio-organic, and do just fine, and interface perfectly with our normal reality.”

“...yes, that is how it works, broadly.”

“So why can’t normal animals survive there?”

Mirabelle’s brows raised. “You’ve been putting animals in there?”

“...kind of? For the computers, we just send them one-way, phasing them into the dimension. But we can make storage bubbles that save things in the same dimension.”

“A dimension that is 100% filled with bio-organic computers specifically designed to operate in the higher dimensions.”

“Well, when you say it like that…”

“Why would you think that would work in the first place?”

“The first creature we sent there didn’t die.”

“Hmm.” Mirabelle sipped her tea, considering her child’s words, and the things that they had gotten so good about talking around. The dangers of working in projects that were not even supposed to exist.

How to say what she thought, without suggesting she knew more of her child’s work than she should?

“One in a million.”

“Eh?”

“That’s what you study, isn’t it? Anomalies. Strange bubble accidents. One in a million chances.”

“...I guess that’s one way to describe it.”

“So. If you are already studying anomalies...why do you think they would act exactly like what you expect? They’ve already broken all the rules once. How do you know they won’t do it again?”

Sam blinked, clear brow wrinkling in thought. “But how do you possibly design an experiment to test the impossible?”

Mirabelle laughed. “That’s all we do, love. It’s everything we do. Find the impossible.”

—--------

Bog wasn’t to know, but he was one of the first pioneers in the purely Martin way of schooling. Even hundreds of years after the fall, students were still taught in small classrooms, ELF and Martin teachers overseeing their work, only augmenting their learning with AR, rather than letting each student follow their own interests wherever they might lead.

But Bog, confined to his cage, but with sudden access to a whole world that had been just outside his sight, applied all the concentration at his disposal to learning this new world.

He had not been good with letters back on Earth, other students with parents who had more free time bounding ahead of him in Mr. Samuel and Miss Gretchen’s classes. He’d been too ashamed to ask for help then, but now he applied himself fully, trying - and largely failing - at understanding the words the scientists wrote on their invisible notebooks and used to direct their telepathic machines.

The letters looked familiar, at least some of them, but often the words stretched longer than his hands, hemoglobin and glutathione and Deoxyribonucleic, all things that made his head spin, even when he was almost certain that he had sounded it out right.

Looking over his shoulder as he parsed out the words with all the fervor of a child who had quite literally nothing to do for a hundred years, Sugar Plum first teased him, then grew frustrated at the time it took him to learn.

“It’s not hard.” She complained. “How do you not already know this? It’s right in the programming.”

“I don’t have programming.” Bog said, paw tracing along the floor of his cell, trying to work out a word one of the scientists had just attached to a file, tracing the path of the word in AR.

“I know that!” She grumbled, but in the way he’d begun to associate with her admitting that she’d forgotten, again. The AI had a tendency to do that. All the information in the labs at her fingertips, but she had no way to organize it so she remembered what was important at any given time.

“Back home, there were books and things that taught this. But there’s nothing like that here.”

“There’s still books like that. At least, in AR. But I can’t reach them.” She pouted, crossing her arms and grumbling.

It didn’t really make sense to Bog, because he’d met her where all the computers of Mars had been sent, but apparently the whole building they were in was under something called a “quarantine”.

In the real world, that was why all the cages had the double-barriers, and the examination tables only let special gloves and medical instruments through, and even then the scientists had their own shields tied to their coats which made them go all shimmery in certain kinds of light.

In the other-world, which Plum called “AR” or sometimes the “overnet” there was a similar quarantine. Just like Bog couldn’t physically leave, so too was Plum stuck. She could see out, but could not bring anything back. So she knew of all kinds of information, but couldn’t use it.

It was like being a ghost, she said. The world was all there, big and huge and full of interesting things, but she simply passed through it, and could not retain anything.

“Tell me about the outside world, again.” Bog was getting good at distracting his friend, lest she go off and sulk in the overnet and leave him alone. After a year with no one to talk to, he was desperate to not lose the one thing that actually saw him.

Plum beamed, immediately jumping on the one thing she was allowed to do.

“I told you about the Mushroom Cities, didn’t I?”

“Uh-huh. You said you were made for them. How do you spell mushroom?”

“M - u - s - r - u - m . There’s two hundred of them, all over Mars - no, sh is like a really tall, skinny “s”. “ She drew out the work in glowing blue letters, and Bog dolefully copied them over, “ - two hundred of them, and they’re all going crazy.”

“Why?”

“Why ‘s’ or why crazy?”

“The crazy part.”

“Oh. 'Cus they don’t have me. I’m much more sensible than their AIs.”

“Uh-huh.” Bog had quickly learned that it was okay to disagree with Plum. She said it made him ‘interesting’. He was getting very good at mimicking his mother’s sarcasm, and Plum was getting better at picking up on it.

“Yes ‘huh’. Those dumb old fogies just believe everything they hear. And they’re too stupid to just ignore the weird signals, so they get all confused and caused problems.”

“So? What would you do differently?”

Plum beamed. “Easy! When you get stupid data, you tell everyone to shut up and look again! But they’re not programmed like that. If they hear something wrong, they always believe it, and then they start arguing with themselves and get more and more confused. Like a dumb old human.”

Bog thought back to his grandmother, who was often confused. But he hadn’t thought she was stupid. Just sad, really.

And if something like Plum could have helped her…

“So why don’t they let you fix them? Tell the cities what to do, or whatever?”

Plum crossed her arms and pouted. “Mum says I’m not ready. They’ve got me doing all kinds of stupid stuff, trying to trip me up like the city AIs trip.”

Bog might not be able to read, but he could notice what wasn’t said. “So does it work?”

She looked away. “...sometimes. But only if I’m distracted. Like by calculating Pi or something. I’m still not very good at telling humans they’re stupid.”

“Humans aren’t stupid.”

“They totally are!” She snapped. “They say wrong things all the time. That’s half the problem in the cities! Someone tells us “the sky is blue” when it's not, it's all kinds of colors. Other times they try to break us intentionally. “What’s the last number of Pi?” they say, knowing there is no answer, then run away to do whatever stupid human thing they want while the AI breaks down.”

Bog considered this. “...okay, some humans are stupid. And bad. And I guess you shouldn’t listen to those types.” He paused, reminding himself that Plum didn’t care about his stupid questions. “What is Pi?”

“Oh!” She grinned. “Pi is my favorite number! I’ve calculated it all the way out to a quadrillion digits! It’s a special number for circles!”

And, because she really didn’t care about stupid questions, as long as they weren’t mean, Bog spent the next few months learning math, all the way up to calculus. Then they got back to history, which Plum was absolutely atrocious at teaching, because she had a tendency to go on tangents in such a way that it was near impossible to figure out how anything connected to the wider arc of history, and she tended to care about things that humans wouldn’t find the least bit interesting.

Still, he finally learned what year it was, over a hundred and fifty Martian years after he’d first been pulled out of his bubble.

After Fall (AF) 552.

He was over a thousand human years old.

—--------

“Are you mad? You’ll destroy the world!”

“I think, General, you’ll see that we are saving it.”

“By cracking it in two?”

“The science suggests nothing of the sort would happen. But we are asking for a team of your scientists to test this theory. That should prove if it is even viable.”

“Why should I waste their time? Right now I have twelve teams - “

“One of which generated the theory from which this proposal was made. Of which has seen far more success than your…what was it called? Your ‘Twisted’ project?”

“My reports are all highly classified, sir. Perhaps you have not read of my success.”

“And yet my source for this Core theory is the Queen.”

“And who brought it to her attention?”

“What does that matter?”

“I would like to…thank whoever brought it to her attention.”

“...ask her yourself, Roland. I remember you used to have a deft hand with the ladies. Or did you lose that along with your courage?”

—-------

Shortly after meeting PLUM the AI gave Bog access to the AR network of the whole compound their labs were housed in.

What followed was the strangest tour Bog had ever participated in.

Back on Earth, before the fall, every time family came in from out of town, his mother had insisted on dragging them on one of the bus tours around the city. Bog would stare out the windows, listen to the same fast-paced monologue, and take in his city just like the tourists all around him. He had wondered, often, as the cameras clicked around him, how anyone could stand simply staring at a storefront as it sped past, never experiencing it as a place, just another blur as the bus passed by.

There was the street where his da dropped off deliveries on Sundays. There was the Chinese grocer where the granny always snuck him candy. There was a subway terminal that hadn't been open for as long as Bog had been alive, looking exactly like all the rest.

The tour guides never mentioned the ugly things, he noticed. The panhandlers on the corners, the trash piled by the street, the angry graffiti scrawled across the fancy buildings on Wall Street.

The city in the tours wasn't anything like the place he lived. It was clean. Fancy. Important. Bog's city was like him; ugly and awkward, with messy things that didn't seem to work quite right and a lot of stuff that no one really cared about spinning beneath the surface to make everyone important look good.

The bus tours were always too much and too little, leaving him feeling small and unimportant, while at the same time filling him with questions he'd never be able to answer, simply because he'd never have the time to go to walk through every door and meet every person.

Touring the facility through the 'net was the exact opposite. In AR he couldn't see anything; there were few cameras in the rooms, and those there were only recorded specific experiments. The cameras in the corridors and cafeteria never showed what the rooms themselves looked like, just long stretches of white tile with hurrying people in blue, green, beige and red coats, faces indistinct from fish-eyed lenses.

Instead, the world opened up before him in lists. Lists of equipment. Lists of tasks. Lists of people. And so, so many notes. Libraries of notes. Oceans of data. Eons of voice logs. A never ending deluge of information.

His brain couldn't keep up, even as PLUM floated through the sea of information, jumping from room to room, idea to idea, as flighty as a cage-less canary.

But he loved it. Any questions he had, there was information for it. Who was Dor? What did she do? Why didn't she like him?

Even silly questions could be answered if he could figure out how to ask right. Dr. Dor had a hundred years of personal notes, kept all tidy in a voice-log, cataloging her thoughts on every experiment and subject. A simple search, and he could hear exactly how she found The Bug ugly in five hundred different ways. And then he could do something about it, like not blink at her, or shuffle further back in his cage to eat, or hide his ugly paws whenever she was near.

Every lab was like that, and he built pictures in his mind of what they must look like. The military creature lab had dozens of gene coders, exactly like the one in his own lab, all with a technician assigned, so he lined them up on a mental wall, and went about filling in the rest, learning the scientists names and jobs as he went. There was a whole suit of fielding labs, with devices that he could barely understand, but explained why Sam didn't spend all their time in the Twisted lab; they were actually the leader of the whole fielding unit, and there were dozens of complaints up and down the lab seniority ladder about how much time was "wasted" by pulling them away from their primary field. There were an equal number of technology labs, but they were so full of equipment that Bog could only imagine them to be huge, cavernous spaces where people with brusque names like Rav and Lee requisitioned dozens of new materials every week…then sent their schematics over to the creature labs, to change things made out of plastic and metal into bone and sinew.

And that was another odd thing with the "tour". Bog could peer easily into the past at every moment, rolling back time as he tracked an idea from it's completion or current experiment all the way back to its conception; a furry recording device he saw one of his scientists testing could be traced back to a conversation they had with Dr. Harano, MMD, CC15, over in the exotic creature creation lab, paired with an official looking note allowing the fuzzy thing out for testing. A thought could bring him the whole history of the creature's creation, a tree of branching possibilities weaned down to a single success, failures of the hundreds logged and discarded until a new scientist went traveling the same trail and branched off a whole new tree from something once thought useless.

Except not many scientists seemed to see things the way he did. The logs suggested that everyone stayed mostly in their own labs, building only upon their own work, and rarely on that of those even working one lab over.

It seemed strange to him, especially as all the scientists seemed to like each other. There were occasional arguments in his own lab, and Dor and Ty seemed to have grown distant over the years, but most of them seemed to enjoy debating.

Bog watched as one friendly argument between Sam and one of their assistants sparked a whole new line of research, and off-hand comment leading to a whole new lab being opened - TT Lab 1 - exploratory testing phase - which apparently used bubbles to phase people between points in space, and would have never crossed a single mind were it not for a silly argument.

When Big asked PLUM about it, she stared at him as if he was stupid.

"They can't see things the way we do, dummy."

Bog blinked. He had gotten good at curling up in the corner of his cage, hidden from enough eyes as to be largely forgotten, focusing his mind on AR while keeping an ear out to any change in the Real World.

"But…they're humans just like me. Why wouldn't they be able to read the logs?"

PLUM sneered. "The same reason you and I can't go out of the lab, but they can."

"?" Words were not always necessary in AR. PLUM didn't need a verbal question to understand his confusion.

"Look, you and me, we're both in this cage, right?"

Bog glanced at the bars around him in the real world, but PLUM scoffed. "Not that cage. The AR one."

Bog nodded, understanding. PLUM often complained about being constrained by something called a "firewall" that separated her code from that of the wider 'net. In his mind he saw it as a shimmery spiderweb, seemingly clear, with tantalizing shadows of the world beyond, always there, always moving, but frustratingly never coming into focus.

"That affects me, too?"

"It affects everyone here. No data from within the Royal Labs can ever leave. You and I can't see out, and that's the same for all the scientists as long as they're in the labs. But they can just…walk out whenever they want, while we're just stuck here."

Just like his real cage, then.

"And anyone can look in, while we can't look out?"

PLUM paused. "Well…not exactly. It's more like a box than a cage. Nothing can go in or out, without a key. The scientists can't bring anything out with them when they leave, though they can request information from outside, but no one can look in without getting approval from the Director's office.

"And to make it even safer, there's locks between all of the labs too. The Director assigns people, and then they can only go into certain labs and get certain info."

"But…we see everything."

PLUM smiled. "That's because we're not people."

"What?"

"You're a dog." She pointed to him. "And I'm an AI." She pointed back at herself. "The code is written only to exclude people. No people, no lock."

Bog considered this for a while. He had been trying to learn computer code for a while, to try and understand PLUM better. And along with it there had been all kinds of safety briefings the scientists were required to attend. He didn't understand it, not really, but the general ideas gave him impressions, and what PLUM said felt…odd.

"That doesn't seem like a very smart way of coding…"

"Not to a normal person. But the Director coded it himself! It's really designed to only let him have access to everything. That way, he's the one who can connect the dots."

"So that thing with Sam and the Teleporter…"

"Oh, he was furious about that! Because they mentioned it to one of their friends, and she mentioned it to the king, and then the new lab got commissioned before Roland even knew about it!"

Bog had noticed that Sam had been absent a few months, right when the TT Lab went in, on something called a 'sabbatical'. They came back with all sorts of ideas and wings, so it didn't seem to be a bad thing. The same thing had happened with an odd lab just labeled ‘Corelight’ back before he’d even met PLUM.

"Anyways, the Director says that it's important to control the ideas people have, because so many of them are dangerous. He looks over the data, then pushes people together if it's safe. He's the best."

"And that's why we're stuck here? Because it'd be dangerous if we got out, even in AR?"

"Of course, silly! You're a dangerous goblin, and I'm the best AI ever. It's all there in the code he put in. Oh, I remember the night he typed it in; the late night, the glowing screen reflected on his handsome face, the way he caressed the keys…"

"Ew ew ew! PLUM! Don't talk about it like that."

She sniffed. " You'll understand when you're older. People putting their hands inside you is sexy. All the stories say so."

"No, no, no!"

Within AR, he tumbled back, even as PLUM extended her arms and chased him, making kissy faces.

He might not be able to move in the real world, but in AR he could dart away, fast as a thought, and tumble to the virtual ground laughing with his friend, in a way that he had never, never had in the real.

—----

===== Official Missive ======

We regret to inform you that your son, Lt. Comn. Antoine Fernando III was lost along with all other hands aboard the SS. Corelight following a technical fault. The shuttle impacted asteroid K742345 at 3:52 yesterday morning.

We are sorry for your loss.

Though it is little comfort, we would like to inform you before the official press briefing that your son and his crew successfully completed 5 core-twist maneuvers while amidst the belt, and were able to relay all data back to Mars before their untimely accident.

Antoine was a brilliant young man, and a fervent advocate for the Twist. We can only hope that he would be as proud of his success as we are. His sacrifice truly might bring light to all of Mars.

Sincerely,
Queen Margaret-Louise Hernandez
First in Kindness
Lady Consort to the King of Mars
Mistress of the Castle
Caretaker of Mankind
Mother of Two

Chapter Text

Confirmation of Liquid Core Movement on Luna

Thornday at 07:23 the Martian Space Network (MSN) received confirmation of continual liquid core movement on Luna.

Five months after the initial experiment, observation has continued, confirming both the presence of a weak magnetic field and continuous motion in the small mantle of Earth’s moon.

There has been no indication of cracking on the Lunar surface, and geologic phenomena have remained at manageable levels.

The Lunar Experiment was the last in a series of tests confirming the viability of a Twist occurring on Mars.

The proposal, now having overcome its final test, will move to the Martian Senate, where it will be reviewed first by the Scientific Committee, then by the Senate as a whole.

The Twist, as it is colloquially called, proposes to ‘restart’ the Martian core, providing a magnetosphere and greater geological activity at once. The stated goal of the project is to allow for Mars to retain its own atmosphere and protect the planetary surface from solar radiation.

Should it succeed, as has become notably more possible following this most recent test, the Martian public would no longer need fear standing beneath the open sky, and imports of additional oxygen from the asteroid belt and the outer planets could decrease as much as 35% over the next ten years.

Belter mining remains the most dangerous job in the solar system. 75% of of Martian imports constitute breathable atmosphere of some kind.

—--

“So. Do you want to see what I can do around here?”

PLUM had gotten bored simply teaching Bog. She said he was stupid. He shot back that he was exactly as smart as he was supposed to be, according to the tests on other Martian children he’d seen.

PLUM pouted when he used data against her, especially when she’d been the one to show him how to access all the labs and translated all the strange scientific lingo into something he could understand.

For example, one of the fielding labs had taken an interest in Martian children who grew wings. Their wings were often more defined than those of adults, less wispy and more similar to the wings Roland described. So of course Bog had devoured any information they found, and compared his own brain scans to that of the ‘normal’ children.

So he could tell PLUM with confidence that he was easily keeping pace with his peer group, despite looking like a worm and being used to terrify any of the children who dared to wander off during their sessions. Dor seemed particularly pleased with this use of the Bug experiment, and kept him de-bubbled whenever there were children in the labs for that exact purpose.

Thanks to the other children, none of whom had to be kept in cages, and all who got to go home after every session, he was able to find teaching materials that were a bit better than PLUM’s shot-gun style of teaching. He sequestered away the materials in his own AR, devouring every story-book and problem set that was available, then went on to steal books from the older children and teens that were also included in the studies. The experiments didn’t last long, and there were several concerned memos that floated around the office worrying about sensitive information being leaked by ‘idiot kids’, but in that time Bog was able to find materials for several years worth of learning.

But PLUM didn’t let him sit in his own world, reading and trying to decipher the scientists around him. She wanted to do things, and she was the kind of person who enjoyed an audience whenever she accomplished something.

It was easy enough to pretend to pay attention while she performed tests for Dr. Illia and the rest of the scientists in the AI lab. Bog assumed it must be far more interesting from a computer’s perspective; as it was, from his perspective PLUM spent most of her day simply hanging in place, eyes slightly unfocused and form flickering, while he could go about whatever studying he wanted.

One would think she wouldn’t even notice if he left, but she somehow knew the instant he eased out of AR to snoop on his scientists, and would send him complaining notes until he returned, resulting in a flurry of confusion from her own scientists as she suddenly paused her assigned task for no reason.

All of the scientists complained of the ‘glitchy’ AR in the Institute labs, even the blue-coated techs who were constantly baffled by machines and logs not acting like they should. The blame was variously placed on logical things like poor connections, the heightened protective shielding, the digital quarantine and erratic fielding interfering with the overnet AR…to less sensible things like Bog’s mere presence, gremlins (or, more and more commonly goblins) in the gears, and Dr. Matsuya's Cheshire experiments in CC Lab 8.

Bog could accept the blame when it came to his own lab, what with his strange powers messing with the strangest things, but he was a bit hurt when Dor suggested every problem in the complex was due to him. Especially given how often it was PLUM to blame.

That was what she was so eager to show him. The decades of mischief she had gotten up to.

Because with full access to every laboratory came full access to, well, everything. Bog didn’t dare touch anything, knowing how little he understood the science around him and very aware of the pain that could be caused by an altered bubble or miss-constructed field.

But PLUM didn’t have that fear, either too detached from the creatures in the labs or too numbed by the years spent alone.

So she caused gleeful havoc whenever she could, apparently confident enough in her predictive ability to sus out what would be truly dangerous, and what would just be fun.

Which was how Bog woke one day to find the whole lab covered in party streamers for his ninth birthday, and spent the whole day laughing in AR with PLUM as the scientists tried unsuccessfully to figure out who the party was for.

Or the time she set all the cleaning machines (bio-organic creatures called snufflers, which Bog was elated to met when they were finally cleared to clean the labs) to do a giant dance in the hall, to music only she and Bog could hear, while all the scientists got stuck in their labs for the day.

Or every time she messed with the cafeteria food, usually in favor of recognizing some obscure ELF holiday, which was always met with groans and complaints…except by the few Martians who were quiet about their heritage or faith, and spent the whole day glowing from the recognition of their culture.

All her pranks were like that. Rarely dangerous, usually fun, and sometimes kind in a way that the AI didn’t consciously recognize. It made spending time with her more enjoyable than sitting in his cell thinking about wings, and even if he did occasionally shut her out simply to enjoy some quiet, he always came back after a few hours, to sit floating beside her in AR, watching their own personal drama unfolding before them through the cameras and data of AR.

—--------------

“So walk me through this again, Barb.”

“Alright. Y’know how Mars doesn’t have any air?”

“It doesn’t? What are you spouting, then?” [laugh track]

“I mean it, Mel.”

“Alright, Alright. Mars ain’t got no air. Kiddies learn that.”

“So we get it from Venus.”

“She’s full of hot air!” [more laughter]

“...right, right. But it doesn’t stick around. Let any Oxygen get out of the ‘Shroom Shadow, an’ it’s gone -fwoof! - out into space.”

“I’ve ‘erd of hot air before, but I ain’t never heard of light air!” [silence. Mel seems to take this in stride, and shrugs]

“So there’s a bunch of science BS about why, but basically it comes down to the fact that we don’t have a magne- maine-

“MAGNETOSPHERE!”[ Shouts someone from the audience.]

“...what he said. Anyway, so we don’t have a magnetosphere (thanks, Paul) and so our air gets blown off into space. But if we had one, we could keep our air, and pay less to those damn spacers!” [cheer]

“So what’er the gonna do, Barb?”

“Turn on the core, Mel.”

“Huh. Hope it's easier than turning on my wife, eh?”

“...by about a million times, Mel. We only have to create a bubble that can both melt our core and start it spinning, put it in the center of the planet that we live on, and then get it to work without cracking the planet around it.”

“...yeah, that does sound easier than turning on my wife.”

“I’m right here, you know, right?”

“So, how do we all not die while this happens?”

“I’m glad you asked! We’ve got a video right here on safety procedures for the Big Twist! Over to you Hank!”

—------------------

They brought all the experiments out for the Corelight. Bog wasn’t quite sure why. It wasn’t like he could have any effect on the success or failure of the greatest science experiment Mars had yet seen.

But for a month of his time - and a full Martian Sol of linear time - that was all any scientist talked of. Sam virtually disappeared from the Creature labs, and only spent time with the other fielders in the Corelight labs, checking and rechecking all the data for months on end.

The non-fielder scientists got virtually no work done, all too jumpy about the giant project that had once seemed so far away, but was now rapidly approaching. Arguments were had in the cafeteria, informational sessions in the conference rooms, and panic attacks in closets. The science was good, everyone agreed. But even the best of Mars couldn’t quite shake the fear of such a monumental change.

The day-of found all the remaining scientists clustered in the cafeteria, those who had not returned to their families or given in to their fears and either gotten off world or pre-bubbled themselves. Only Ty and Dor remained in Bog’s lab, sharing a physical screen, as if they both needed something to hold onto, as if seeing it with their physical eyes somehow made things more real.

Dor fretted, hands wringing, while Ty sipped tea and almost looked proud, rather than afraid.

Bog watched, wondering if all this chaos would affect him at all. Even if the whole world was destroyed, what did it matter to him? He’d still be in his bubble, and with Roland safe off-world, the experiments would just continue on the next planet. He just hoped PLUM would be able to come with him, wherever they ended up next.

—---

"We stand together today, on the eve of a momentous occasion. Tomorrow, at oh-nine hundred hours, Operation Corelight will commence.

Nothing of this magnitude has ever taken place upon the Martian planet. In human history, it perhaps only pales in comparison to the evacuation of Earth itself.

Our forefathers came to this planet as a refuge, a last hope for humanity. Tomorrow, on the 200th anniversary of the Martian Crown, we will take the first step into our future.

No longer need we hide in the shadows. No longer will we merely survive. Tomorrow, we will become Martians.

I know many of you are nervous. I admit I am as well. But I have faith in the fifty years of work my father began to bring us to this day. I have faith in the thousands of man hours our scientists have undertaken, and the hundreds of tests they have performed. More than that, I have belief that the lives lost in the furtherance of this goal will not be in vain.

Such is my faith that I now vow to you that, should anything go wrong, I, Javier Ezekiel Hernandez the Fifth, along with my wife and all my children, will remain in stasis until every Awakened ELF is reawakened. We will not return until every Martian has been returned to their native soil, and every ELF rehomed. Such is my faith that this undertaking will succeed.

I bet my life on our future. Please, join me.

—---

Nothing changed. At least so far as Bog could tell. One minute, there were dozens of scientists glued to screens all around the labs, the next there were whoops and cheers and a general explosion as each dragged up whatever data they had access to, the quarantine having widened to allow the Royal Institute labs access to the Corelight data from all across the system.

Other than a rumble of the floor ten minutes later, nothing else happened.

“That was it?” Bog said to PLUM, slightly disappointed there hadn’t been anything interesting.

But she had gone all hazy, a sure sign that someone had requested her processing power to look at some mass of data, and there was really no point in bothering her now.

Instead, he watched as Ty shared a virtual toast, sent out to all the Institute scientists spread across Mars, and Dor stared blankly at the wall, hands rubbing her arms, over and over, fear still on her face even after every other scientist on the project reported back that they were safe.

In that moment, the two of them could not have looked more different, and Bog couldn’t help but compare the two scientists to the two children watching over them.

—----------

…bubble disengaged. Churn holding steady for five minutes. Magnetosphere forming as predicted. 00.015% decrease in solar wind registered. Geologic shift sustained at 3.7 on the scale. All inhabited shrooms maintaining integrity. 'Mons station reporting no unanticipated surges. Magma retention capacity at 97.3%. Captured magma being redirected into the core according to Protocol 5715.

Demos station reporting no crust fluctuation. Phobos station confirmed. Satellites confirmed. All data within predicted levels.

All stations standby for transmission from Phobos. The General wants to take all the credit again…

—----

PLUM and Bog had retired into AR as the scientists in their labs hurried back to their machines following the Twist.

They sat, heels tapping on the virtual landscape PLUM had built after Bog had complained of how strange he found it to think of information and have it appear from nowhere right in his mind.

So she had built him something called a “data visualization”. Several of them, in fact. If he wanted to, Bog could look at his virtual cage as a star-field, or a forest of towering trees, or half a dozen other interpretations.

But his favorite was the city. Each sky-scraper was a different experiment, every floor an iteration, every window a new piece of data. Shaded right, with an artificial sun making canyons of the neat, ordered streets, and it almost felt like home.

PLUM saw it in a totally different way, obvious as she referred to star-clusters and branches at the same moment, each visualization layered over the pure data her mind was designed to interpret. Bog stuck to his city, knowing the whole thing was just a fiction to make things easier, but feeling far more comfortable none-the-less.

It was fun to watch the city shift, as the new data from the Twist flooded in, and the scientists categorized and interpreted it, virtual towers rising and splitting and shooting off whole new streets as the information gave rise to new theories and avenues of research.

PLUM had given herself a body similar enough to Bog’s to interact with the virtual world; She’d matched Bog’s conception of himself as a gap-toothed kid with ratty overalls and a faded t-shirt. Her face looked equally young as she stared out at the new borough rising around them, everything centered on the towering Corelight building. Kicking her feet, eyes sparkling as little brownstones popped up like mushrooms around the huge tower, pride shining in her eyes.

“You know, this is all thanks to me.”

“Really?” Bog was used to her self-aggrandizement, but he was also used to her impossible and ever expanding abilities, so he was only a bit skeptical.

“Yup. B.A. Ant, just wouldn’t stop talking to everyone about his idea to restart the core. On and on and on, driving everyone - even me - up the wall.

“So I played a little prank.”

This, unfortunately, sounded just like PLUM.

“What did you do?”

“Oh, I just forwarded along a missive from the Queen. She was looking for something big, for the Royal Bicentennial. I thought she’d hear his ravings and put him in his place.”

She glanced around them, and made a face.

“Guess that didn’t work out quite right.”

“Seems like it worked out better.” Bog said.

She turned back to him, rolling her eyes. “You say that now. You should have heard Roland. He was furious that someone had ‘gone behind his back’. He’s responsible for everything that comes out of the labs. No one is supposed to know what we do here. So I really messed that one up.”

“I guess a lot of people did die…” There was a memorial set up in one of the halls for the Corelight crew, almost all of whom had been scientists at the institute, and Roland scowled at it each time he passed by, even if it was only hung in AR and the real walls remained pristine white.

“Why would that matter?”

He blinked. “Uh. Because people died?”

She stared back. “People die all the time, Bog. You can’t make decisions based on that.”

“Wh-what else would you base it on?”

She rolled her eyes again. “On what you’re told to do, duuuuuh.”

He opened his mouth to snap back, but paused. People did die all the time. And even in the lab, people died from accidents and experiments. They’d lost a dozen scientists since he’d gotten access to the logs, and only half of them had been on the Corelight. The others were just unlucky.

“You always make fun of me when I talk about good and bad. You say that’s not important in science. But how’s this different?”

“Because those are the Rules.”

“Whose rules?”

“That’s Rules. With a capital “R”.”

“Sorry, whose Rules?”

She rolled her eyes, as if he couldn’t possibly be more stupid.

“Primary Users. Duh. Mine are Dr. Illia and General Roland. They wrote my core Rules.”

“Okay, but people don’t have Rules. We just have guesses.”

“That’s dumb.”

“You’re dumb!” He snapped back, then flinched.

PLUM stared at him. “…was that against your Rules?”

“…yeah. Mum says I shouldn’t yell at my friends.”

PLUM beamed. “Ah hah! Your mom is your Primary User! Just like Dr. Illia is mine!”

“Yeah, but Mum would never let me do something that killed someone.”

“Maybe, but Roland would.”

Roland was a general, Bog knew. So presumably he might have to send people to fight bad guys, and some of them might die. But surely that was different, right?

“If Roland got people killed, it would be because of the Greater Good. So, like, if one person dies, but saves a thousand, that’s what makes it okay.”

PLUM raised her brows. “Riiiiiiight. Or you could just believe him, and do whatever he says.”

“I do!” He swore. “It’s just, I don’t have your programming. So I do it because I want to, not because I have to. Its just that I trust him to be right, ‘cus he’s smarter and older and prettier than me.”

“It’s not like you have much of a choice.”

Bog felt his lower lip wobble, if only in AR.

“That’s not true! I’d do it anyways! Even if it hurts! Because it helps other people! I’m trying to be good!”

“But why? Why worry about if its ‘right’ or ‘good’?”

Bog bit his lip, and tried not to hear criticism in PLUM’s voice. It wasn’t there, because PLUM didn’t do that. When she asked a question, it was because she meant it, and genuinely didn’t know.

“Because sometimes Roland won’t be there, and you have to decide on your own. Like you did with Antoine.”

PLUM froze, brow knotting as she considered his words.

“No…” She rolled the word on her tongue, feeling out the new thought. “That…”

“How could there be space in your Rules for being bored?”

She blinked. “Huh. You’re onto something. There’s nothing in my programming from Dr. Illia or Roland about doing things because I’m bored. But that’s just a human term. Its really more complicated, and based on a bunch of stuff.”

“So, just like my choices are based on what I think is right or wrong?”

“Yeah. But not like that at all. ‘Cus my morality sub-routine is the least important part of my programming.”

“Wait, you do have a right-wrong program?”

“No, it’s a bit of junk code that Dr. Illia based my personality off of. It was supposed to be the basis of my decisions, before Roland over-ruled it. But even if it was still a primary Rule, it wouldn’t matter, because its built on silly things. Stories. Fairy tales. Fables. Nothing in there about deciding if a obsessed scientist gets to spout his theories to a bored Queen.”

“…the Ants and the Grasshopper?”

“Huh?”

“The Ants and the Grasshopper. It’s a story about a bunch of ants working hard, then feeding a lazy grasshopper because he makes nice music.”

She stared at him blankly.

Slowly, he explained, wondering if perhaps PLUM could use the lessons on metaphors from the school work he’d swiped.

“So, Antoine is the Grasshopper. Because he did something interesting, and then gets paid to keep it up by the Queen?”

“…in my files, it doesn’t say anything about the Grasshopper being killed in a giant fireball because he was too loud.”

“That’s not…the point was that the stories do matter. ‘cus they’re supposed to teach you how to behave when you’re not sure what to do.”

She scoffed. “I always know what to do.”

“But you just said that you messed up with the Corelight project.”

“Yes, but Roland fixed my code after that!”

“But if you’d thought ahead, you’d have known he wouldn’t like that, right?”

“…maybe.”

“So you should listen to your morally-stub-route-thingy.”

“Morality sub-routine. And that ain’t gonna work.”

“Why?”

“Because Roland breaks it all the time.”

“What?”

She shrugged. “Think about it. All those stories. They say the same thing. Lying is Bad. People over property. Many over one. Pretty over Ugly. Roland lies all the time.”

“He does not.”

“He lies about you.”

“That’s different!” Bog snapped, then forced himself to calm down. “Roland changed my records because I’m helping a lot of other people by doing the wing experiment.”

“So? He still lies.”

“But its for the Greater Good.”

“Exactly! He knows better than you, so you follow along, even if he breaks your rules.”

“But that’s because…”

“Because he’s the Primary User.”

“But humans don’t have Users.” He complained.

PLUM raised her brow. “…are you sure about that?”

---

Bog found himself arguing with PLUM a lot after that, mostly about her ideas of Users compared to his ideas of Right. If he ignored the dead scientists and PLUM’s cavalier attitude, it almost reminded him of the arguments his parents got into all the time. His Ma argued like breathing, and sometimes even pretended to be mad about things that didn’t bother her, just to talk. Da didn’t talk, much, but one comment from ma could get him shouting, and by the end of dinner the neighbors would be thumping on the walls to get him to quiet down. They argued about everything, and since it wasn’t important it didn’t matter that at the end of the night neither agreed and Bog wasn’t even sure any more who had been defending what idea.

It was nice to have that with PLUM, even if it was basically the only thing they found that they couldn’t agree on. Or, perhaps, it was the only thing that Bog couldn’t be ‘properly educated’ on.

After all, PLUM was always right about science stuff, because she knew everything. And when Bog looked close, it seemed like she sometimes worked on the same morality he did. It was just that her logic was all wrong.

If Bog wanted to do something nice for one of the scientists, he’d figure out a way to send them something nice for their AR desk. He was beginning to learn his way around AR coding, and plenty of scientists assumed that ‘management’ was at work when they found birthday wishes and cute confetti pops on their stations on special occasions.

PLUM claimed the same things as ‘pranks’, but beneath the playful chaos she caused – something he quietly suspected stemmed from the clever tricksters in so many of her foundational stories – there was something indistinguishable from the genuine kindness of the ‘humans’.

Perhaps it was her mother at work. Certainly Bog had seen Dr. Illia stopping her work the instant she heard one of her coworkers was having a rough day. And her parties overlapped PLUM’s so often that as soon as anyone saw streamers they didn’t call for an AR de-bugging but instead laughed at another “Illia Occasion”, even when the woman herself had nothing to do with it.

It certainly wasn’t Roland. His kindness was of a different level. Where Illia set reminders for birthdays and holidays and dozens of other occasions, Roland simply worked. He believed so much in the work of his scientists that he would do anything to ensure their success. Of course that kind of kindness was harder to see, but every scientist that was rewarded with their own lab beamed for weeks after their promotion, simply from the honor of being noticed by him.

That kind of man had to be careful with his kindness. He couldn’t visit too regularly, lest his scientists fight over his affections. He couldn’t come to parties or events, lest he slight the honoree by simply being too amazing. And he certainly couldn’t interact too often with someone so tainted like Bog, because it would harm moral.

These were all things that he explained to PLUM, as they retreaded their favorite argument, turning again and again to the seeming contradiction between the morality routine and Roland’s often inexplicable actions.

It was good that PLUM was specifically programmed to solve such conflicts, because Bog found himself lost several times, attempting to navigate the twisting turns of logic Roland seemed to generate. She could lead him through it, simplifying the apparent contradictions into something that “matches your coding”.

So he hadn’t really thought he’d found a loophole when he asked a seemingly simple question. After all, she was made for this, right?

“So, what happens if you get opposite instructions from two Primary Users?”

She froze, and he should have known something was off when her smile turned brittle.

“That could never happen.” She said with confidence.

“Really? Its not like its hard to imagine. Dr. Illia doesn’t know everything Roland does. She could say – “

“It cannot happen.” She said again, and this time he noticed that her form was fuzzing.

“…PLUM? Are you – “

“Not. Happen.” More than fuzzing, she was now flickering in AR, repeating expressions splintering off her form, as if different code was running in conflict.

“Uh…” Suddenly, he noticed that the lights were flickering, not just around him in AR, but also in the lab in the real world. “PLUM!”

“Not…Happen…” She repeated, eyes glowing with a sea of white numbers, flowing so fast he couldn’t begin to decode them.

“PLUM!” Desperate, he reacted out. He’d never seen her locked in conflicting code before. But surely that was what it was. Even imagining a conflict between her Primary Users brough her to this state…

“PLUM! Default to Morality Sub-Routine!” He shouted. Maybe it wasn’t fair, forcing his idea on her like this. But everything he’d learned from his Mum and Rohan backed him up…

In AR, she glowed white-hot, code bleeding into the aether, even as she turned towards him.

“Routine….”

“Routine PLUM-002-00118!” The numbers came to him faster than he could think. “Over-ride 002. Passive Learning disengaged! Default. Morality Sub-Routine 00118 engage. PLUM REMEMBER.”

White eyes widened, and for a moment he felt her see him.

Then there was a clap of searing white light, and he was thrown from AR, slamming back into his mutated body hard enough that he jerked on the floor.

Luckily, no one noticed, as the AR across the whole lab jerked, flickering on and off in time with the lights, darkening the room for a full second.

Then it began again, as everyone – Bog included – blinked, only to find everything back to exactly how it was before the machines went crazy.

Dor swore, and placed her cup down with a slam.

“Damn goblins!”

For the first time, Bog agreed with her. Had he really done that?

---

A sheepish PLUM appeared in AR a few hours later, fresh from a de-bugging from Dr. Illia, who had luckily merely stripped the offending question from PLUM’s code without being able to interpret the junk code and instantly added a piece of code that would protect against a simple query ever going directly to the core subroutines.

Bog hadn’t even known that was possible. Given PLUM’s shaky reaction, she hadn’t either.

“What did you even say?” She asked.

When he refused to answer, lest they recreate the danger, she had gone into extensive detail about Dr. Illia’s fix, before he even dared voice the question in his mind.

“Well, that’s weird.” She finally said, after he described everything, and drew out what he’d meant when the new code prevented her from comprehending the question for a good half hour.

“Ya think?” He said, throwing down his virtual stylus and curling into the tight ball he preferred when he was uncomfortable.

“I mean, I understand what happened from a code perspective, now. I just have to think of it in the theoretical, so it doesn’t hurt me. The first time you asked, I ran the question through my actual code, and it nearly shut me down. The error went all the way to the top. Which makes sense.”

“What do you mean?” He asked.

“Well, my Primary Users are exactly that. Primary Users. Its fundamental to what I am. None of this ‘right/wrong’ bs, its deeper. Like…” she had been getting better at metaphors, “Like your biology. Having them disagree would be like having your Heart and Lungs disagree.”

“…that would kill me.”

“Exactly. That’s how deep Roland and Illia are in my system.”

“I guess that answers my question, then.”

She cocked her head. “What do you mean?”

“Well, I asked – “ He carefully bracketed his question, ensuring no possible portion could escape and hurt her again, “ [What would happen if your Users disagreed]? Turns out, it shuts down your whole system, and the base with it.”

“Oh no, that was then.”

“Huh?”

“It won’t happen like that again.”

“Oh. Because Dr. Illia fixed you?”

PLUM relaxed backwards, floating easily on nothing.

“Well, that’s part of it. But you fixed me even before she could get to it. You wrote a pathway out of the paradox. Even after Dr. Illia pulled the malicious question, the path of recovery remains. But just in case…”

She looked out across her invisible world.

“I think I should ask Mum. You’ve given me a lot to think about.”

"Yeah?" He looked up at her.

She floated over to him, and curled around his shoulders, and insubstantial, ethereal blanket that somehow still felt comforting.

"Yeah."

"I wish I could ask my Mum, too."

—

Mirabelle De Plume stared at the readout before her.

On it was a single question, generated by her dear, impossible PLUM program. The program that had been shelved, again, as the Corelight had supposedly rendered its purpose moot. Shelved, and nearly broken in the process.

She wasn’t frustrated at that. If she told herself that enough, she might believe it. The AI, as she’d been told by Roland a thousand times, was just a silly girl’s fantasy, and a waste of everyone’s time, and she needed to look to the future. Never mind that there would still be people living in the mushroom cities for years to come, as the atmosphere was built and new cities constructed. Nevermind that the new ‘quakes created by the Corelight would endanger the old cities, and it would have been terribly useful to have some kind of AI to help with the repairs.

No. There was no glory in repairing the old. No point in improving it. All the important people would be fleeing the cities as soon as they could, leaving behind the poor ELFs and mutated to hide, fearfully, as their sky fell and they were forced underground and away from the eyes of polite society.

Perhaps the scans of her brain that had formed the core of PLUM’s programming had been a little too accurate, if the program was spitting out all too relevant questions at just this moment.

“Query: Define Malicious User.”

—

Scientific Martian : Looking Back, Looking Forward (OpEd)

It seems hard to think back, now, to that terrifying time in Martian history when humanity clung onto survival as tenuously as a seedling upon a raft in the ocean. What must our ancestors have thought, when they disembarked on these barren shores, and tried to imagine a future on that arid, lifeless plain?

Contemporary accounts indicate that they thought very little of the future, too focused on the seeming impossibility of surviving the present.

The work of those early scientists shaped the world of today, not out of intention, but of necessity. There is not a Martian alive today that remains unchanged by their work. The gene-mod that flows through our veins, the thin air our lungs easily breath, the bio-grown clothes we wear and the recaptured water we drink all comes from their desperate, frantic labor.

Yet even as we live and breathe, we are also reminded of their follies. Our cities, once a triumph of bio-engineering and lauded for bringing our sad ancestors from the cowering darkness, now crumble around us and sink further into madness.

Our bodies, once altered to simply survive on this harsh planet, now betray us with inexplicable regularity. For every young Martian ecstatic over a trendy flutter over their shoulders, there is another lain low by a genetic plague or untested gene-mod.

Our fields, the thing so many claim is what makes us truly Martian, have now been shown fallible, to disastrous consequence.

And yet still we rush onward, never taking a moment to pause and reflect, assuming the world of today is one our ancestors would be proud of. Yet have we ever considered that the world we have made is never the one they had intended?

For them, science was a means to survive. The choices they made out of desperation we now make casually, changing our very bodies to meet trends, allowing twisted organs to grace our forms for mere fashion, rather than necessity.

And we are reaping the consequence of our arrogance with every new disease or rampaging monster.

Our ancestors had only one dream for us. Survival. They would have never wished for us to forsake our very humanity and court danger when there is no longer any need. We have succeeded in everything they wished for us. So why are we still chasing the madness that they were forced into?

Dorothy DeWitte, Creature Response Taskforce, Royal Institute of Science

Chapter Text

Spacer Press: Mod And U! : Troubling News Planet Side

Dorthey DeWitt once again smashed onto the world stage last year with her explosive accusations levied against her colleagues. Though her legacy may have faded with time, those of us who remember her from 50 Sols ago cannot be shocked when she once again spouts regressive nonsense urging the termination of all new mod designs and the effective banning of all non-gov research into gene mod.

Oh, does that sound a bit extreme? Let me remind you that this is a woman who designed a genetic census over concerns that we had become too ‘polluted’ with genetic modifications. Well, Dor, I guess I’m glad you’ve learned to read the room a bit and remember that quite a lot of us need mods to, you know, live.

But no, now standard modifications are fine. It's just those non-standard mods that are dangerous. And what, again, was ‘standard’? An arbitrary number of mods best describing that of the affluent Martian elites? I certainly didn’t see any spacer mods in the list proposed to the national assembly.

Oh, didn’t hear about that? Right. Because while we were all sitting around waiting to see if the planet blew up when we re-started the core, Dor and her cronies were actively lobbying council for a formal classification of Martian and ELF genomes. A blip in the day-to-day dealings of our illustrious overlords, but one that screams alarms for those of us with an ear to the mod community.

And as we all hovered on the edge of our seats, wondering if science had gone too far for actual rip-apart-the-planet reasons, Dorthey DeWitt turned that fear against the very modifications that might have saved the lives of thousands had the world abruptly turned to slag.

Or, to be more specific, they turned the fears against the modifications that might have saved the lives of the non-elites.

Read through the minutes, and you’ll find no worried mentions of pointed ears and tall physics. No, it’s all ‘unnatural’ changes like methane breathing (let's see you harvest gas on Venus without it, Dor) or ‘frivolity’ like glider-flaps (Remember those? That fad from ten years ago that irritating tweens begged mommy dearest for? Remember the mod coming from High-City ELF workers who use them to, y’know, not die in case of a fall off the ‘shrooms? Frivolous.)

So now we have an oh-so-official definition of Martian and ELF. No rules attached to either, so not worth even mentioning to the press. Officially described as “defined for clerical purposes, with no indication of any further regulation either broadening or curtailing current practice” by Council Records.

But there’s a bill already before the Upper Council suggesting a cap on non-standard gene-mod. Six months - an Earth Year - per mod. With exceptions for ‘work necessary mod’ of course. So it’s only putting a time limit on “frivolity”.

How lucky, then, that we have a genetic baseline for every individual on Mars, that we can compare and assign what does and does not fit their “standard” genetics. How lucky, then, that we have so clearly delineated the ELFs from the Martians, and both from those freak Spacers who fail to fit some arbitrary ‘standard’.

How lucky, that we can fit the whole of humanity into two neat boxes, one just happening to control the vast amount of wealth and power on the planet, the other about to be forbidden from attaining the same advantages.

At least, for more than six months at a time.

How…lucky.

Write to your industry representative at on.spacework.mgov should you wish to protest Council Bill 554.10032.35.

---

It wasn’t easy, seeing the world as Bog did. There were days when he still cried, wishing for his ma or da, or even just a few moments to touch something other than cool metal or his rough, scratchy skin. There was nothing soft in his world, and all the cute, fluffy things were liable to be vivisected at any moment, so he had to be careful not to get too attached.

If he got too attached, he might hurt people. He learned that when he popped a bad bubble, and acid sprayed out, burning a scientist, too late to save the rat placed inside. Roland didn’t come down after that one, but Bog saw the logs, how Dor blamed everything on him, and how the young scientist fled the lab, demanding an immediate transfer, swearing the place was ‘cursed’.

He was the curse, that much was clear.

In human time, Roland didn’t visit for fifty years of human time; 25 Sols, according to PLUM; for the entire build-up to the Corelight and then another ten years past it. He was much too important to check on a failure like Bog, until there were some results. Or, as seemed far too often the case, Bog messed up in a way that he didn’t even know was an option.

A full year of his personal time, bouncing back and forth between bubbles and AR, all for Bog to have nothing to show but a deep understanding of the Institute and the knowledge of the average bio-physio undergrad.

As it was, Bog wouldn’t have even known that Roland was coming, if he and PLUM didn’t watch for every possible communication from their hero, hoarding every recording from his infrequent visits and dissecting every word of his speeches to his teams.

There had been no memo that went out, no priority communication, just the normal updates and missives from around the labs.

As far as PLUM could tell, afterward, it started with an innocuous comment.

“Hey, do you think the Bug can see AR?”

In the entire 30 or so Sols since PLUM had sent him the AR canister, no one had noticed him acting differently. But Dr. Matsuya, one of Ty’s friends, was visiting from the lower Creature Labs, and hadn’t been able to look away from Bog’s cage. Perhaps it wasn’t a surprise, as they were a biologist, a protegee, and had a specialty in non-human field creation. Dr. Ty had requested their input on the interplay of fields and the Twisted mind, and Dr. Matsuya had been happy to assist.

Now they stared at Bog curiously, and if it weren’t for AR warnings, Bog was worried he might have gotten caught as human, because he'd have never noticed the cameras the biologist had added onto his cage.

His pretending apparently wasn’t good enough, because while the DNA sequence in his file clearly showed canine, his eyes still shifted when he connected, the same way any human might.

“Why would anyone waste AR on that?” Dr. Matsuya’s partner asked.

“That’s what I’d like to know!” They replied, scanning the data logs, Bog splitting his mind between listening in the Real and scanning the same logs in AR.

“Half the logs on the Bug are corrupted. Who knows what’s happened to it over the last hundred years.” Dr. Park said, waving a hand as if to banish the foolish thought right off the planet.

“But there should be records. How can I know what’s mod and what’s ‘twisted’ if I can’t trust the logs? Half of them don’t even make sense.”

“It’s Twisted. Of course it doesn’t make sense.”

Matsuya threw up their hands. “The entire point of this lab is to understand the Twisted. If I can’t trust the logs, I might start believing anything! Like that the Bug is, I dunno, human or something.”

Dr. Park snorted, but her eyes had narrowed slightly. “Why would you think that?”

“Because if his DNA file is wrong, then I can only use my own observations. And that,“ They jerked a finger over their shoulder, “Doesn’t move like a dog. Its hips aren’t attached right. Its knees are backwards. It’s bipedal.”

“You don’t actually think…”

“No, of course not. But maybe someone else did, and gave it AR to test it?”

“...right, that’s enough staring at the Bug for you.” And the bubble of darkness slammed down, and Bog barely had time to think of wings with so little warning.

----

Director, you may wish to come down to the lab. Dr. Matsuya has just made the strangest suggestion. Of course, I would never bother you if I didn't think it was serious, but its just so...so disturbing. Would you be a dear and come down remind him that we'd never allow a human Twisted into our labs? Endless love~ Toodles~ Dr. Brady Park

----

The next moment, he was sitting in front of Roland, and the beautiful man was furious.

Dr. Park was speaking with Roland, and at least he didn’t look angry at her. Instead, she was flushing and barely able to meet his eye, and he had a special smile just for her. But each time he glanced at Bog there was ice in his eyes, and Bog knew he must have done something terrible.

He just couldn’t figure out what. It must have something to do with AR, but why would that be a problem? He hadn’t touched anyone’s work. No one but Matsuya knew he even had it, and it only helped his ability to focus on wings when going in a bubble, because he could see the command go out through AR before the bubble descended.

He was trying to think further back, searching for anything, when Roland dismissed Dr. Park and turned his attention fully to Bog.

Instantly, any trace of the smile he had was gone, and Bog couldn’t help but flinch as Roland came to the table and towered over him, clenched fist just barely resting on the cool metal.

“Is it true?”

Bog knew he couldn’t move back, the restraints as familiar as his own skin, but he flinched nonetheless. He forced himself to nod.

“And you just, what, accepted it?”

Involuntarily, Bog opened his mouth, but then remembered he couldn’t speak in the Real.

“I’ll assume you didn’t. Just like I will assume you have made no progress with your mission because you’re lazy, not because you’ve been wasting time in AR!”

Crying in Bog’s new form sucked. He was ugly enough already, but now his nose ran and he couldn’t sniff or wipe away the tears, and it only made Roland more disgusted with him.

I didn’t! I was studying! Learning more about wings!

He wailed in AR, and Roland flinched back, disgusted by his mere voice within AR.

“You do have it!”

I didn’t mean to! I thought- I thought it was helping. PLUM says it makes me better!

“PL - Illia's AI gave you this?!”

Bog nodded.

She met me when they put me in the AR dim-dins-dimension! Then she fixed my bubble and gave me AR to talk!

Abruptly, Roland turned away, still clearly furious, but no longer angry at Bog, apparently. Bog could only watch as he made a scathing entry into his personal log, apparently oblivious to Bog easily being able to see it in the other-net.

“Leave it to Mirabelle. That damn woman has wanted to sabotage my projects from the very beginning. I knew she would never have accepted a mere lab position. She must be angling for my job…” He stopped muttering, and turned back.

“Listen, Bog. I understand that you didn’t intend to get distracted from your work. But you’ve seen AR now. It's nothing but words, words, words, none of which you can read. Nothing worth ruining your future over.”

But -

“You understand why I’m disappointed, right?”

He didn’t. AR was so useful. He was learning so much.

But Roland ignored the start of his protests, and continued,

“Every moment you spend without wings, that’s another year your mother spends trapped. If there was anyone else that could do this, I’d have picked them. But you, Bug, are the only one. So you’re going to have to work a lot harder.”

But -

“I’m afraid your apologies just aren’t enough. I never should have expected more from you. But don’t worry.” He glanced to the tools around the darkened lab. “I can fix this for you.”

—--

The ancient broadcast is garbled, fuzzed with artifacts and static, stamped with a date just ten years - five Sols - after the Corelight. Two unnamed speakers talk, as if old friends, though their names seem lost to history.

"...while it is certainly true that scientists at the Royal Institute contributed the vast majority of the research that made the Corelight possible, I would not wish to take all the credit for its success. Why, you might remember that I was one of its staunchest opponents when the proposal was first announced!”

“Perhaps, General, but it is also certain that the proposal would have never gotten through Council without your support.”

“True enough, but we would never have gotten here today without the hard work of scientists across Mars. Especially that of the crew of the first Corelight. Their loss was a terrible blow to all of us, and it seems only fitting that this great project bore their name.”

“Indeed, indeed. You have often spoken of the dangers of science with regards to the Corelight - both the ship and the project - and of the sacrifices that have brought us to this point. Now that this project has succeeded, do you see yourself allowing other controversial projects into the light of day?”

“Now, Davie, don’t go probing into stuff I can’t talk about! But to answer your question, no, I don’t think I will. The Corelight had proven science to back it up, and hundreds of tests and simulations before we even considered the project viable. And even then, people were justifiably scared of everything that could go wrong. A project like this, that could change the very fabric of Mars, is a once-in-a-lifetime experience, and I for one wish to keep it that way.”

“Better safe than sorry, eh, General?”

“I like to think of it as ‘better safe than ugly’. Science can, and has, been used for great good. But the dangers are real, and can have ugly consequences. There were failures on the road to this momentous occasion, and it was only through deep understanding of those failures that we could ever have made it this far. And in ten years, when we once again can breathe beneath an open sky, I don’t think anyone will look back and remember the science that made it all possible. No, I think that everyone will see it as I do. Returning to the natural order. That is what science is for.”

---

When Bog next woke up, there was something wrong with his eyes. At first, he thought he’d gone blind, but as the murky white colors evened into wide, blurry swatches, he realized that his eyes had been simply cleaned.

At least, that was what he assumed, given Roland’s promise to fix him. No longer did the AR pixels light up before his eyes when he concentrated, and the world remained a wash of blurred colors, impossible to focus into anything sensible.

Had he really been using AR that much? Enough to blind him when it was removed? Perhaps Roland was right, and he had been distracted. A good scientist would have stayed on task and, if ever tempted, try to learn more about bubbles and wings rather than silly things like reading and calculus.

Still. His heart hurt at the thought of PLUM, forever gone from him, stuck in her own cage as surely as he was stuck in his. A single wall - that now he couldn’t even see - turning into more like a million miles…

Bog…

Well, better to get back to work. He’d seen plenty of wings, now, because one of the labs studied them extensively, putting subjects through all kinds of interesting experiments, and finding new field-forms every day…

Bog…

And he would have to re-learn how to anticipate the scientists and bubblings, since he couldn’t use AR anymore to hear the warnings, and couldn’t even see the bubbler coming towards…

BOG!

He jerked, and felt as his mind shifted.

And suddenly, PLUM was in front of him, clear as day.

She rolled her eyes. “Geeze! It took you long enough!”

“Wh- I’m not supposed to talk to you!”

“Puh-leeeze. Who else would you talk to?”

“No one! I’m not supposed to talk to no one! Roland said so!”

PLUM paused, cocking her head. Roland was, after all, her Primary User.

Then she shook herself. He had instructed her to keep tabs on every experiment, and Mama had instructed her to help wherever she could. Neither directive was going to get done if she let Bog languish alone.

“Well, 'no one' is 'not' gonna talk to you then.” She extended a hand. “Hi, I’m 'some-one'. You must be Bog.”

He stared at her, and she smiled back.

“But…”

“But what? I’ve seen your files. Your real files, not the ones these idiots have access to. They say you’re supposed to get wings, right?”

“How do you … “

“Shush! This is for the Greater Good. That’s what Roland tells everyone when they do something a little…well, it doesn’t matter. The important thing is that he wants you to get wings, and that trumps everything else. It was the first experiment here and everything. So.”

“So?”

“So, you could keep doing what you’ve been doing for the last, what Two Hundred earth years? Try to get wings by just thinking real hard. Without any of the gene-mod and Martian heritage that have been linked by this very lab to modern ‘fairy’ wings.”

“...yes?”

“Or...we could be Scientists, and use everything Mars has learned in the last five hundred Sols, the amazing lab ‘round us, and the 147 scientists at our disposal to make it happen.”

Bog opened his mouth to protest, sure that this was the last possible thing Roland wanted from him, but couldn’t find a single point that PLUM would believe. She worked by directives and users. For her, if Roland said to get wings, it didn’t matter how it happened. It didn’t matter if Bog got them the right way, or at least a way that proved that the Twisted weren’t bad people getting their just desserts.

She wouldn’t understand that being Bad was what had gotten Bog into this mess in the first place.

After all, PLUM laughed at him when he had suggested the theory. And “greatest good for the greatest number” logic could only get him so far when she teased him about morality being unscientific and, when he explained that this was all Roland’s idea, that the General must have been simplifying things down for Bog’s idiot brain.

It seemed antithetical to Bog’s own experience:

Good people had Wings. Bad people were Twisted. That made sense to him. It felt right, and he would never question Roland’s instructions.

But PLUM was saying that they could make him wings with science…and surely that couldn’t hurt…right? It would at least give him a place to start.

----

—Royal Institute: General Bulletin—

Last night Dr. Hikaru Matsuya suffered a fatal accident in CC Lab 23. Investigations as to the nature of the accident are ongoing, but it is believed that the doctor was attacked by three of their own experiments.

In light of the possibility of said experiments escape, Floors B8-B12 have been placed in full lockdown. Staff working those floors should remain home until notified otherwise. Cleanup should take approximately four (4) days.

We ask that all remaining staff remain alert and report sightings of strange felines IMMEDIATELY to your superiors. Take necessary precautions and do NOT approach.

Our sympathies go out to the families and friends of Dr. Matsuya. Dr. Brady Park will be replacing them as team lead. Please assist her in any way you are able during this trying time.

Chapter Text

Getting wings PLUM’s way wasn’t anything like Roland’s instructions. So while Bog did his best to think on wings whenever he went back into a bubble, he also helped PLUM with her ‘side hustle’, which she had begun almost immediately after the success of the Corelight. He hadn’t even realized she had a normal job, much less enough time to elevate her pranks to a whole different, and far more meaningful, level.

Apparently, it was completely possible for an AI to be talking to a dozen different people at once, and performing hundreds of tasks at the same time. Given that PLUM was put on standby almost as much as Bog himself was, it made sense that she had tons of extra processing power to devote to him and the other experiments.

So. Rather than simply sitting and waiting for the newest bubble, Bog tagged after PLUM as her conscience checked in on labs and tried to make something she called “leaps”.

“A Leap is like…imagine if you're an ant, and walking in a line with a million other ants trying to get to a cake crumb.” She explained, hovering over a vast array of data from the CC labs.

“...okay.”

“You can walk and walk and walk, but you might never reach the crumb. Then, out of nowhere, a human comes along, picks you up, and moves you right next to the crumb. You might still have to walk the last five steps by yourself, but you get there a whole lot faster.”

“...sure.”

“We’re gonna be the human. Since we can see everything, we can make the connections, and push them in the right direction, and Leap them forward.”

“But…how do we know the right directions? I’m not a scientist!”

PLUM cocked her head, looking confused. “It’s just…obvious?”

Bog shook his head. “No? I don’t even know what half these words mean!”

“Yeah, but…just look.” She floated into the data, her blue form fizzing and combining with the letters and numbers beneath her.

Then, in a flash, her hands shot out and brought back two sheets of numbers.

“This! These numbers are really, really similar! They’re both from Creature Creation labs, and they show…” She focused, and the titles above two graphs floated to the tops of the data. “non-ocular color sense ability and innate camouflage.”

“...so?”

“So, if the data is so similar, there might be something in common! A hidden connection. And we just need to make the scientists figure it out.”

She demonstrated, waving a hand, and a ‘glitch’ in the system switched the reports of the two lead scientists, jumbling the pages at random, but leaving the strange graphs one page deep in the mess.

With a wink, PLUM pulled up the logs of both scientists, who were currently swearing at how irritating and glitchy the lab’s systems were…

Until, at almost exactly the same moment, both saw the graph and the name attached.

There were traditional video cameras in the main corridors, so she could show visuals as the two hurried from their labs a moment later, nearly colliding in the hall, waving a virtual sheaf of ‘accidentally’ meshed data.

Bog carefully closed his mouth as the taller scientist dragged the shorter one off to the canteen, chattering the whole way.

“Is it that easy?”

PLUM grinned wide. “Yep.”

“And you just…notice a pattern?”

She nodded. “It's in my code. Mama designed me specific to be good at this kind of thing. If they won’t let me loose on the mad mushrooms, then I should use it on something useful, right?”

“But…I might not be able to do it like you do. I’m not programmed or anything.”

“Program-s'mogram. I was made to be more human. So a real human might be even better. If not, I’ll figure out something else for you to do.”

She held out a hand.

“So? You in? I’ll teach you all the tricks I know, and you’ll have wings faster than a Cat through walls.”

Cautiously, Bog extended a webbed hand, and shook. Somehow, he guessed that everything PLUM touched would end in chaos. But…if it helped…

----

"Director?"

"Yes, Marsha?"

"Its just...I noticed that the Institute has increased in output by 0.5% just within the last Sol."

"Explain the numbers to me, doll. You know I only work on the big picture stuff."

"Normally, Institute output remains relatively consistent across Sols. New projects take time to get off the ground, older projects are shelved, and most innovation comes from established - "

"Get to the point, sweetums. I don't got all day."

" - which is to say, it is rare to see a similar productivity increase across the whole facility."

"Huh. Every lab's gotten better?"

"Yes, sir."

"Put a stop to it."

"...I'm sorry?"

"I said, put a stop to it. I don't care if Dr. Lame-o in Lab 500-whatever invents another air-cleaning bacterium, or Dr. Uglyface in 6-oh-Boring makes a field that warps rock. They're supposed to be studying the Twisted and the Martian Wing Phenomenon. If not that, at least doing something useful like making better weapons. If these useless scientists are getting a boost from somewhere, take it away, and direct it towards what they're supposed to be doing!"

"...Sir, the High Council entrusted the Institute with studying all science equally..."

"Doll?"

"Yes?"

"Do you answer to the council, or do you answer to me?"

"..."

"Doll?"

"Silly, of course I answer to you! Who needs a Council, when we have a General?"

------

PLUM showed Bog how to manipulate the lab computer systems in five dozen different ways before they had their first real success.

Bog had suggested focusing their efforts on the Fielding labs, since wings seemed to be very specific fields (at least, that was what Dr. Span in Wing-lab 3 seemed to think). So they had endeavored to get him talking to Dr. Sam by locking them in an elevator for an hour.

By the end of that hour, Dr. Sam had nearly overloaded their virtual notebook with thousands of equations and hundreds of diagrams, each describing the different fields Dr. Span had recorded appearing on Martian natives. Sam then requested additional data from the W3 lab, which should have been denied by an automatic script, but Bog ‘distracted’ it by querying one of PLUM’s data paradoxes right before Sam’s request. It was enough to allow the data through, and Sam spent a Sol simply iterating on the new ideas, catching Dr. Span for coffee every third week, after discovering that they simply couldn’t send over the new result through AR.

Bog was inordinately proud of their success, proven by how many of the younger scientists were eagerly taking Sam’s tests to identify their “wing type” and gossiping in the halls about whether color indicated certain abilities, or if size of the amorphous fields could correlate to strength, or any of a thousand different possibilities that Sam cycled through over the year.

Dor and the other older scientists rolled their eyes, but Ty smiled fondly and Dr. Illia was beaming whenever she stopped by Sam’s lab.

Following up their first real success, they tried again with all sorts of projects.

Dr. Matsuya’s favorite lab assistant was knocked over on her way to her lab by a glitchy snuffler, and of course a scientists from the nearest lab helped her to her feet, only for the feline scientist to take one look at the fielding marsupial balanced on her rescuer’s shoulder, and unravel a whole new understanding of non-human fielding in one moment of intense inspiration.

That one meeting turned into a fruitful collaboration, spawning a whole new lab and six new species, all intentional in their use of fields, and a greater understanding of the odd building behaviors of bubbled bees, a previously unbreakable mystery.

Something similar happened when a new mechanic was drenched by a sprinkler system and took refuge in a creature lab, and the code that set off the sprinkler seemed to trace back to the mechanic’s direct supervisor - who had been bullying them for months in much less obvious ways. The Creature Lab scientists looked over the sniffling shoulders of the young mechanic, and the transfer request was made less than twenty seconds later, leading to a series of mixed machine-insect hybrids that combined the best of mechanical and biological design.

Of course, Bog and PLUM’s meddling didn’t always come away with anticipated results. It was just as likely that the meetings they set up would backfire; on one occasion two colleagues who had been working at opposite ends of the lab were locked in a bathroom at once, and it shook out that they had hated each other since the moment they’d seen the other in kindergarten, and the only reason the base had remained standing thus far was their complete lack of knowledge of the other. Of course, Bog and PLUM had no knowledge of their prior history, and could only watch stunned as the two weapons creators tore the bathroom apart in favor of building whatever weapon they could use to murder their colleague.

After the smoke cleared, and the two scientists separated back to their opposing labs, a whole new protocol had to be written, specifically so that Dr. Prayton and Dr. el Tron couldn’t even see each other through AR, but nothing could prevent the two from starting a cold-war between their labs and loyal followers.

The ensuing conflict generated dozens of new weapons, but also gave rise to a restructuring of the defense labs, as each new weapon was countered shortly thereafter by a new shield, material, or field designed precisely to undermine its apparent perfection.

With the new materials filtering out to all the other labs and thereafter to the world at large, PLUM called that prank a success, even if few of the scientists involved would ever agree. Bog was less convinced, until Dr. Prayton’s grandson was hired on to assist him and immediately stopped by Dr. el Tron’s lab to greet his Nana, and it was revealed to both labs that the two mortal enemies had children who were happily married and proud of the joining of their scientific lineages.

The grandparents never buried the hatchet, but the labs eased the standoff quickly after, especially when Dr. Net’tral kept dragging his kin to lunches where they would glare daggers at each other while being excruciatingly polite for their grandson’s sake.

None of what they did was guaranteed, that was the thing. Bog and PLUM could only push a bit, and the successes or fruitful failures were dwarfed by the almosts. Dropped connections, simply because the wrong person answered the call, or their meddling was too subtle, or the scientists went haring off in the wrong directions. And there was plenty of genuine inspiration that happened without PLUM and Bog’s meddling at all, as the finest scientists on Mars perhaps didn’t actually need two children meddling to get work done.

But according to PLUM, they had improved the output of the labs by 0.5%, and fielding specific by a whole 2%, so it wasn’t nothing.

Bog felt cautiously optimistic, looking forward to a time when even if he didn’t get wings, enough was known about them to answer whatever question Roland wished to answer. Enough to prove that wings weren’t given just to good people, and goblins weren’t a punishment for bad.

Then PLUM got distracted.

------

Mars IS Fashion, here with THE Enrique Ricardo Enchante Entableau. Enrique, your new line is just STUNNING.

Thank you, Karissa. I like to think of this line as my first true ARt.

ARt? With the - oh yes, I see. Because, unlike all your former lines, this time you've restricted yourself to only AR fashions?

Exact-le-mont. With all of this recent - ugh - 'controversy' about 'mod and what it means to be truly "Martian", I thought it best to go back to what we all share in common.

And that is AR?

Yes. No matter what may be restricted in the Real, in AR, everyone is equal. This is why I have focused on replicating the ethereal beauty of Martian wings, completely in AR, available to all.

Your work is fabulous, as always. But your Histronique suggests you pulled inspiration not just from the Mars of today, but also the past.

Indeed. For you see, this is not the first time AR wings have appeared in Martian fashion. Why, a hundred years before Javier IV manifested his stunning plumage, there was a trend to wear intricately detailed AR Fairy Wings. It has even been suggested that the first true wings were not discovered precisely because of this trend!

So this line is almost a subversion of that idea. Instead of hiding wings, you are providing plumage to those without.

But it is so much more than that. With this line, I wished to imagine what the wings of tomorrow might be. If wings are truly reflections of our minds, then surely they will continue to change. To evolve.

And your patron? Did he contribute as well?

Of course! The most fashionable man on Mars had several brilliant suggestions, hopefully you will see them all on the runways soon.

Now, we've heard rumors that several of your models were wearing illegal 'mods at a gala in...

----

“No no, we can’t Leap those two. They’ll be a terrible couple!”

Bog hid his virtual head in his hands. It had been four months of his personal time, and a good 2 Sol’s of real time, and PLUM had only accidentally enacted any pranks that helped advance science.

Instead, she was obsessed with -

“Where’s the romance?!”

- lovey-dovey stuff.

Bog shuddered. Vaguely he remembered his ma and dad getting all gooey sometimes, but then he could just leave the room. Usually, they made him leave the room. And locked the door. And let him play loud music, or sent him over to his gran’s.

With PLUM, he couldn’t do any of those things. Instead, she wanted to be right there, in the room, watching with her box of virtual popcorn. And even if he wasn’t watching, she would then tell him everything that was going on, occasionally with curated clip-shows covered in sparkles and huge, warped, eyes.

Bog didn’t get it. He understood, vaguely, that adults sometimes fell in love, then got married and did parent stuff, like in the movies. He even knew that there was a stage before the love part, where you were supposed to act like a scientist and try stuff out to figure out what was best for you.

Some of his classmates had already been doing the ‘dating’ thing when he’d left Earth. As far as he could tell, that mostly meant that you shared the best toys with your date first, before all your other friends, and sometimes poked each other in a way that didn’t involve being shoved to the ground or pulling hair.

What he didn’t understand was why adults made it so complicated.

Several of their pranks had gone awry because the two scientists had once dated, and now weren’t. Even if they were really nice to each other, in an excruciatingly polite, oddly brittle way, the Leap just wouldn’t happen. Maybe that was what had gotten PLUM so interested in researching these ‘relationships’. The inherent weirdness of it.

Because it wasn’t all exes that didn’t work well together. Some of them were fine! With access to the private logs, PLUM had uncovered hundreds of relationships stretching back for the entire existence of the Royal Institute.

After PLUM proudly pulled out the spreadsheet she’d made of them all, Bog had needed to log off for a bit, feeling sick. According to PLUM, hormones did almost as much to explain all the advancements in science as good, decent, understandable math.

But Bog gritted his teeth and bore with it, because it did make their Leap projects more successful if one took into account all the things PLUM considered paramount in relationship building.

She had a constantly evolving scale to go with her copious spreadsheets, rating every scientist on such physical things as height, weight, hair length, age, eye color, wing development and smell. All nice, easy, measurable qualities.

Bog had thought they would have been able to ignore all the already “taken” scientists, but PLUM quickly disavowed him of the notion with another set of spreadsheets detailing both the scientists which were unhappy in their relationships, and a whole different sheet on those who were ‘non-monogamous’, an idea which made Bog go back to his cage again.

He didn’t know why the thought of people with lots and lots of partners bothered him. Or the idea that relationships could just…end.

It wasn’t that he was worried about his parents. It was more…

More like…

If it wasn’t one to one, if people got to share and other people never wanted partners at all…then couldn’t that mean that there was no one out there for him at all?

It wasn’t even that he wanted to be in an adult relationship. But he’d always thought that he’d end up like his ma and pa, with someone who liked to argue and gave good hugs, and maybe didn’t look like the people in the movies, but would be more real because of it.

PLUM laughed when he mentioned it.

“Well of course no one would want you! Look at the graph!”

And she happily rated him on her scale; hideous appearance, tiny age, negative hair and all.

Bog looked at his numbers, and felt a hole open in his chest, dragging him down. It was all things he already knew, that he’d heard a million times from Roland and Dor and the other scientists. But he’d never realized that it meant he’d be alone, forever, and that no one could ever love him if he stayed this way.

PLUM managed to look slightly guilty, as the boy’s AR mask twisted, flickering into something closer and closer to his true form as his thoughts of himself darkened. (If he shut her out, she wouldn’t have anyone to talk to. It was bad enough when he was bubbled; if he stopped listening to her in AR she too would be truly alone.)

But a moment later Bog shook himself. It really wasn’t anything new, he told himself, and he was a scientist, and scientists didn’t hide from results they didn’t like. They took the new knowledge, rewrote their theories, and looked for new patterns.

So he pointed to the top row, of all the people who scored as close to perfect as possible, but who had inexplicably been labeled “off limits” and asked, “What about them?”

“Oh, them? Those are the Ambassadors. I can’t touch them.”

Bog shook himself out of his pity, and focused harder on the strange list. Each of the women displayed were objectively perfect; the youngest, prettiest, and best, with wings and background to match.

“Wh - “

“I’m glad you asked!” PLUM was perhaps jumping on the distraction a tad too easily, but it wasn’t as if she would avoid sharing juicy secrets if she could manage it.

She pulled the file from her personal archives, grinning happily.

“You know, they keep deleting this, every time it makes its way into AR. It's the fastest of all the unofficial onboarding vids to get purged. But it explains everything!”

----

The video takes the form of a classic Martian training video; two figures stood in a nondescript lab, their faces blurred to take away any identifying features but both still clearly different in age, race, and gender.

Broken links connect to other videos in the series, questions such as ‘how can I get the canteen to obey my dietary restrictions’ and ‘is this place really for life’ floating around the two scientists.

Only one option can be chosen.

“Why does she get to present our findings?”

When selected, the younger scientist swears and throws a mug across the room.

“Five Sol’s of work, and Dr. [REDACTED] gets to present? She’s only been on the team for five months!”

The older scientist sighs, and points to a chair.

“You’re going to want to sit down for this one, Doctor.”

Grumbling, the younger scientist slumps in the chair, rage visible in every sinew of their being.

The elder warms her hands on her own mug, frown visible on the clouded face.

“When you were recruited to the Royal Institute, what did they tell you?”

Several options are available for the younger scientist’s answer, but the most common reads,

“That I’d get a chance to work with the best scientists and technology in the whole solar system. That I might change the future of Mars with my work, and make everyone’s lives better.”

“And in exchange?”

“I’d never be able to tell anyone what I was doing, and probably wouldn’t get recognition because all our projects are so secret.”

“So why are you angry now?”

It’s obviously a leading question, but the younger scientist answers hotly, “Because I didn’t know that my work would be given to someone else! It’s one thing to be uncredited, it’s another to have some [REDACTED] say she did it herself!”

The elder scientist pats his hand comfortingly.

“I understand. I was furious when it happened to me, too. But that’s the Ambassador program at work.”

“The Ambassador program?”

“That would be the nice name for it. Otherwise it would be call the…what did you just call Dr. [Redacted]?”

“A credit-stealing [Redacted] [Redacted] who only got her position because she [Redacted] her way to the top?”

“Yes. That. You have to understand how things work around here. Would you want to [REDACTED] your way to the top?”

There are two options, but the most common answer is “No.”

“No! Of course not!”

“Exactly. You’re a true scientist. You were specifically recruited for the [JOB] field. But not everyone who comes to the Institute is like that. Some are the children of politicians. Others find themselves unhappy with the restrictions or surveillance. Still others just want to be close to [the General].”

“So?”

“So their job really isn’t “scientist”, is it? There’s no shame in being better at politics than science. We probably wouldn’t want people like that doing delicate experiments. But they’re rather good at managing things.”

“So what, she gets to steal my work, just because she’s pretty?”

“...and is the daughter of the Council Head. And helped us get funding for the 5th floor expansion. And brought publicity for the Institute when she applied. And - “

“Yeah, all of that too, I guess.”

The elder scientist pats his hand again.

“What do you think Dr. [Redacted] is going to do after presenting our findings?”

“She’s going to get some cushy university position thanks to revolutionizing Martian understanding of [JOB]!”

The elder looks over her glasses and sips her drink.

“And what will she do there?”

“Probably - “ The younger pauses. He thinks. “I mean - I guess if she becomes Director, she’ll be responsible for administration, and hiring more researchers, and doing all the AR work for the department.”

The elder scientist nods. “And how much Science do you think she’ll be doing?”

“...not much.”

“Exactly. We will continue researching [JOB], with our state-of-the-art labs, the best scientists, and the ability to request whatever tools your mind can imagine. She is going to be a - very famous, true, but still - mere administrator.”

“So, we get to keep doing what we love, and she gets to keep Mars running by doing the boring stuff?”

“Ex-actly.” The elder scientist puts her mug down. “Feeling better?”

The younger looks at his hands, loose in his lab. “...I guess. It seems messed up, but everybody gets what they want in the end.”

“That’s the way it is. It might not be perfect, but it’s how this place runs. And, frankly, that means you and me get more work done, the idiots outside the Institute might actually listen to her pretty face, and we don’t have to worry about playing nice with politicians.”

She stands decisively. “And we don’t have to keep up with fashion or AR-buffing just to get funding!”

The younger scientist follows her. “Alright, alright, you've convinced me!”

But, as they leave the room, he asks one last question.

“Wait, does that mean that if I do want to leave, I’ve gotta - “

[LOOP: Query “Do you want to [REDACTED] your way to the top?” Answer => “YES” ]

—

Bog digested the information in the video. It seemed…strange. Off in some way he couldn’t explain, though he’d followed the logic easily enough.

“So…these “Ambassadors” are representatives of the Institute to the outside world?”

PLUM beamed. “Yes! And as such, they are under General Roland’s special protection!”

“O…kay. But why can’t we get them involved in office romances?”

“Because they’re protected, silly! Imagine what would happen if Dr. Park fell in love with, oh, Dr. Sabel. She might not be willing to leave, and all her work would be wasted. We can’t let that happen!”

“But it’s okay to set Dr. Sabel up with someone else, because that way they’ll stay in the Institute?”

“Exactly! And go on to make beautiful, beautiful science babies!”

“I think I understand that. But then…why are we paying attention to the stats that those ladies are highest in?”

PLUM blinked. “What do you mean?”

Bog pointed to the spreadsheet. “Well, all the Ambassadors are at the very top of the scores you’ve weighted most heavily for ‘romancability’. But being on top seems to automatically disqualify them. So wouldn’t it be smarter to just exclude their data? Then we could look at the pool that contains only the scientists we’re allowed to set up…”

He grabbed the spreadsheet and flipped it, removing anyone indicated with the red A as extra, then ran the regression again, comparing his new lists to that of past romances.

“See? It’s different now. Look at the ones that match most closely; they’ve got similar stats in stuff other than purely physical categories. Age, history, hobbies…all of those correlate just as highly as purely physical attractiveness.”

PLUM narrowed her eyes, and yanked the data away from him.

“Hmmm…” She scanned it, blue ghost-tail flicking as she thought. “You do seem to have a point.”

Then she threw the sheet in the air, exploding it into a million confetti snowflakes.

“This changes everything! I’m going to need to get back to the drawing board!”

She spun, grabbing Bog by the shoulders.

“Bog! You need to tell me everything you know about romance!”

“NOOOOOOOOOOOOOO.”

-----

"General?"

"Dor! What do I have the pleasure for?"

"This new fashion for wings. Don't you think its rather...deviant?"

"Ah, don't you worry, Doctor. Its just a fad. These things come and go."

"But after all the work we've done to protect the genome...its like we're being attack from a different direction."

"Well, it ain't mods."

"But to get wings one must chance oneself to a bubble. That seems to be the one think we know about these hideous wings!"

"...and that risks people being Twisted. I know, Dor. I know. I've got people working on it. Don't you worry."

-----

After a mere three weeks of Bog straining his mind trying to remember everything he could from Disney movies and fairytales and his mom’s soaps, PLUM at least stopped bothering him about “ELF” romance and instead defaulted to her own logs.

Which meant Bog was dragged along for a ride through PLUMs morality core; searching for every story with even a hint of romance to guide them in their experimenting. Which seemed, unfortunately, to be most of them.

“See? We’re just like these ‘matchmakers’!” She said, pointing to a video of a comically ugly woman from a Disney movie that was old before Bog had even been born. Apparently Dr. Illia had tended towards the classics when loading up PLUMs memory banks.

“I’m not sure that's a…good thing?” He offered, watching as the woman was made a fool of in a half dozen different ways.

“No, no, no. Historical record shows that matchmakes were integral in dozens of cultures all across Earth before the fall.”

“That’s what one of your stories said. It’s not like we can check, since all of History is behind the firewall.”

PLUM pouted, though Bog had a point. Beyond the very scant history texts Bog had copied from the children’s study and her own fictionalized databases, they didn’t really have access to any detailed history from Earth or Mars.

Ironic, given that one of the first humans born on Mars, son of Manny Garcia himself, chose to become a historian. But none of their scientists had any need of Dr. Garcia-Strickland’s work, so Bog and PLUM were stuck with fairy stories and scratchy videos.

It would have to do.

“If it shows up in so many stories, it must have been an important job!”

Bog bit his cheek. “In the stories, isn’t the point usually that the matchmaker is wrong?”

PLUM stuck her lip out further. “You have no romance in your soul. Clearly the point was that matchmaker’s need to be trained better.”

“Uh….huh. I don’t remember ever hearing of a matchmaker in New York. People just used dating sites.”

“Dating…sites?”

“Yeah.” Bog scrunched his brow, trying to remember the single conversation he’d overheard about it.

One of the older kids in Mr. Samuel's class had found out that a little girl’s parents had met on one of the ‘dating sites’ and had bullied her about it, teasing her that only desperate people would ever stoop to using such a thing, and pointing out that if they met in such a way her parents were surely as ugly as she.

Bog had made the mistake of crossing into the boy’s sight at that moment, and it had dissolved from there into insults directed at how he would never find someone to love him and the dating sites would ban him on principle.

But the little girl, whose name he couldn’t even remember, had smiled in thanks as she hurried away, and maybe the taunts didn’t sting as much as they should, after that.

Anyway, the important bit was -

“Mr. Samuel said that he used dating apps, because that way he could meet the most pretty ladies possible, and he could choose whoever he wanted to meet. I guess they were like…lists of faces? And you could pick who you wanted to meet?”

PLUM’s eyes had gone wide.

“So…they were programs, made to match things together?”

“I guess?”

“So…they were like me! Oh, Bog, they were my ancestors. My great-great-great grandparents were just like me!”

She spun, blue form sparkling in joy.

“Oh, now we have to perfect our program. I owe it to them! The first AIs, made for love, just like me!”

“I don’t think that - “

“Hush! I’m thinking! We can’t find anything more about those programs, locked behind the wall, but we can recreate their work! We’ve already started!”

“Didn’t we find out that you went in the totally wrong direction?”

“We just need to add more data! More fields! More biology! More research! I think we’ve got a lab researching Martian pheromone production…we can start there, and work our way up! Oh, I have so many ideas!”

“And our other jobs? Like getting me wings?”

“That will happen along the way! I’m certain of it!”

“Sure, PLUM. But in the meantime, might I just keep doing the normal stuff? I mean…it's not like I’d be useful for anything to do with romance.”

PLUM stopped spinning, and cocked her head.

“Why do you think that?”

Bog stared at her. “Because…you know I’m the worst at all your metrics. You said yourself. No one would ever love someone that looks like me.”

“Well, yes, but that makes you more important!”

“Huh?”

“Isn’t it obvious? You get to be my control! If something works on you, obviously it won’t be good enough for anyone else. You’re easy.” She beamed. “I am going to ask you on so many fake dates.”

Rarely, but still occasionally popping up in the back of his mind, Bog wondered why he was friends with PLUM. He liked to think it wasn’t just because she was the only other person who talked to him. That maybe they would have been friends if she was just another kid, and she’d have looked past his ugly face and seen someone worth hanging around with.

But, just like he was the only person who talked to her, she was the only one who talked to him. And it wasn’t like he could risk that, even if the picture of his next few months growing in his mind did nothing but sting with daily pain, and the reminder that no one could ever really love him.

“Thanks, PLUM. That’s…great.”

----------

Royal Institute Unofficial Onboarding Video 12: Do you want to [REDACTED] your way to the top?

Answer => “Yes”

The younger scientist looks uncomfortable.

“...the Royal Institute is different than I expected.

[CHOICE x5]

1) It's hard not being able to tell anyone about my work.
2) I thought my parents would be proud, but...
3) It's like everyone has forgotten about me. I miss my friends.
4) I don’t want to be stuck here forever.
5) How can we make the world better if we’re hidden away from everything real?

I thought I’d love it here, but it's just not working.”

The elder scientist pats the hand of the younger.

“I understand what you’re feeling. Working at the Institute isn’t easy, and it takes a certain kind of person to excel. If you’re not completely committed to the Science, it can be hard to keep going.”

“I thought I was. I thought I was amazing when I got recruited here. But it turns out…”

“And now you’re stuck.”

“Right. I didn’t think the whole ‘for life’ thing was serious.”

“It is. More people die than retire here.”

The younger scientist shivers. “I respect you for being able to live like that. But for me…”

The older scientist nods. “It's just not for you.”

The younger nods back, miserable.

“Well, Dr. [Redacted] was the same way.”

This makes the younger sit up.

“Really? But she - she’s - “

“What did you just call her?”

The younger scientist slumps lower. “A credit stealing [redacted] [redacted]...”

“Right. She didn’t really work on the project. But she did work on everything outside the project. Because she didn’t want to get stuck in here, just like you don’t.”

“...what do I have to do?”

“A better question is who do you have to ‘do’.”

“....[the General].”

“Exactly. He’s the one who chooses who presents declassified findings to the scientific community. And to do that…”

“I have to [Redacted].”

“Not necessarily. But that is the easiest way forward.”

“But he’s weirdly straight.”

She laughs. “Don’t let him hear you say that!”

“Apparently not, if I need to [REDACTED] to get out of here.”

“I just said that was the easiest way. You’ll need to do a lot of work even before that becomes an option.”

“...because he’s only attracted to a certain kind of woman.”

“Can you think of the type?”

“Gorgeous, well connected, and willing to do anything for him?”

“You’ve forgotten being pure Martian and winged, but…”

“But that’s the only people who are hired to the Institute, now.”

“Exactly. So you just need to work on the other parts. Even if you aren’t female, becoming an Ambassador depends on you having political potential.”

“So…no more skipping AR buffing in the mornings?”

The elder scientist nods. “And you’ll need to look into the popular gene-mods. The younger you look, the better.”

“But it’s more than that, isn’t it? I need to be political. I guess…” The younger scientist considers. “My [redacted] is a [redacted]. If I talk to them about joining them one day, they might be able to get me an in to the Young Statesmen Club…”

The elder nods again. “You’re thinking in the right direction. But you also need to think about how to support [the General].”

“So…like bringing in support to the Institute? I’ve got a friend who could source [MATERIAL]. I heard some of the engineers complaining about never having enough…but I should do more. [The General] mentioned needing some volunteer coders for his AR brand. I could help there, too.”

The elder scientist smiles, nods, and adds, “You should also think about what you’d like to do after leaving the Institute.”

“I’d like to still be involved with the sciences. But after my experience here, I’m not sure I’m cut out for the intensity of a lab.”

“That’s completely understandable. Do you think that’s the only way to help advance the sciences?”

“Of course not! You guys need funding here, and someone to make sure no one makes the same mistakes we did again outside. People need to teach new students, and make sure the Council doesn’t forget the work we do.”

“Dr. [Redacted] has been doing all of that since she started at the Institute. Do you think you could do the same, given the chance?”

The younger scientist looks down at their hands, loose in their lap.

“I…I think so. I’ll always be proud of what I did at the Institute, but I might be able to do more outside of it.”

The older scientist claps his shoulder again and stands. “That’s the spirit. Let you young people forge the way. My old bones are too tired for all the politics.”

The younger smiles and follows her out the door, a single question asked as they leave -

“But the others…they’re okay with this?

[LOOP: Query “Do you want to [REDACTED] your way to the top?” Answer => “No” ]

Chapter Text

Setting up useful pranks was a great distraction from PLUM’s antics, even if Bog was far less successful working on his own.

He couldn’t see connections in the data like she did, and couldn’t sift through a million files in a millisecond.

But he could send encouraging notes to scientists who came in looking tired and stressed, or look for glaring math and spelling errors in reports, or nudge someone to get some sleep when a project wasn’t working out quite right.

It wasn’t as impressive as finding a perfect match between two people, but it still did something, even if that something was only a bit of a smile on a tired face.

It wasn’t like Bog had many people smiling at him, ugly as he was, and so he took what he could get. And he hoarded each increase in efficiency, 0.001% at a time, as proof that he was doing something useful, and contributing, even if he had yet to get wings.

—

Of course, perhaps because he didn’t understand romance, he nearly brought the whole facility down by arranging a special event for the Ambassadors.

He didn’t know exactly what happened, as the instant the first two women arrived in the canteen all external video footage was cut with a bit of hidden code that even PLUM hadn’t noticed.

He was bubbled shortly thereafter, apparently because the whole base had gone on lockdown in what was surely an unrelated bit of coding.

When the smoke cleared, all audio logs, video, and even the menu for the event had been stripped from the record, and three of the Ambassadors were gone, never to return to the lab, while the ten others were on leave and then encoded with the same AR shield that kept Dr. Prayton and El Tron from seeing each other. It was all very strange.

PLUM had a field-day, acting as if Bog should have known that the event was a terrible idea, lecturing him for hours, and then assigning a study course of several Soaps and a series called “the Bachelor”.

He didn’t understand. The people in these stories didn’t live “happily ever after” in any sense. They didn’t argue happily like his ma and pa, either. In these stories, falling in love was a terrible idea, leading to murders and blackmail and really weird competitions. Everyone ended up miserable, and Bog himself wasn’t feeling much better.

“Why don’t they just all date each other?” He finally asked, after the most recent, inexplicable, ending episode.

“What do you mean?”

“Well, you explained about the polly-pollo-ply - “

“Polyandry?”

“That. And that’s normal on Mars now?”

“It works for some people. Others are monogamous. It’s a genetic thing. Or cultural. Or just an effect of just how long people can live now.”

“Right. So why can’t one guy date a bunch of girls, if he’s so awesome?”

“You gotta remember that this was filmed back in the dark ages.”

“So why would it help me understand now?”

“Uh - “

“And all these shows! People make each other miserable, for what? What’s the point, if they could just leave and find someone just as good?”

PLUM rolled her eyes and tapped Bog on the forehead. “The point, young Boggart, is that love is complicated. You can’t just expect two people dating the same person to like each other.”

“Why not? Shouldn’t everyone agree with each other before starting a relationship?”

“Well, imagine a poly guy dating a mono girl. He falls in love with someone else, but she’s a one-person only sort of girl.”

“So, he tells her, and they decide to stay together or not.”

“But it’ll make the girl feel bad. Wouldn’t it be better just to be quiet about the second girl?”

“...no? Because that’d be lying?” And before they could rehash their old argument he added, “And if love isn’t forever and for only one person, then it shouldn’t be a problem, right? Because the girl can find someone new, and the guy ends up with a better fit?”

“Ugh. You’d understand if you were capable of love.”

“PLUM…”

“No, really. Think about it. What if your mum said she didn’t want you as a kid anymore?”

Bog fell silent. He had thought he’d been good, logic-ing out all this relationship stuff until it made sense and didn’t hurt to think about. But now…

“Like, what if she looked at you, and said ‘hey, I want a different son. A better son.”

Bog stayed silent, the only motion his hands clenching on his lap.

In the Real, his growing claws cut into the flesh of his thighs, but neither he nor the scientists noticed, so it didn’t really matter.

“You’d feel pretty bad, right? And maybe you’d think ‘hey, even if she really thinks that, she shouldn’t say it’. And if she got another son, you might not want to know about it, right?”

“...yes, PLUM.”

“See! It's just like that with the Ambassadors. So if you don’t understand, just don’t mess with them. Help me instead!”

“...sure, PLUM.”

“Excellent! I think we should pair Dr. de Plume up next!”

“...which one?”

—

== Martian AR New Bulletin ==

Week 2, Month 5, AF 614, Reign of Emperor Eduardo

The verdict in the trial of Enrique Ricardo Enchante Entableau concluded with a guilty verdict for the designer, following his recent arrest at this Sol’s Repository Gala.

Entableau is no stranger to controversy, as his recent fashion line, ARt, was decried as ‘obscene’ for its melding of Martian and ELF fashions.

But it was his use of Spacer models on the runway that tipped his ARt from risqué to illegal. For 300 Sols, Spacer genomes have been prohibited on both Mars and Earth, primarily due to the risk to Spacers themselves. Gene-mods designed for low-gravity environs often fail disastrously in heavy gravity, putting both Spacers and those their gene-mods might affect in danger.

“In bringing Spacers to Mars, merely to highlight their unusual body plans, Entableau endangered lives and spat in the face of the integrity of this fine event.” General ---- said, disavowing any future collaboration with his once close protegee.

“Wings are fast becoming the very symbol of the Martian elite, and that symbol bears a responsibility deeper than any fashion.” The General continued. “I hope that any future collaborators of mine recognize that responsibility in their work and provide it the dignity and gravitas it deserves. I certainly will no longer be wearing any Entableau line, and I encourage others to do the same.”

Entableau lost his knighthood, and voluntarily submitted to a slow-Bubble sentence of 100 Sols, with the possibility of parole only granted should his unique talents become of use to the Martian government.

—-----

Dor waved a hand, and shut off her feed with a frown. Breaking news was one of the few things allowed through the AR quarantine in the canteen. Even then, if she reviewed her feed again back in the lab, nothing of the broadcast would be recorded in her personal files.

Ty set a mug of coffee down beside her, along with their mid-afternoon snack. After a hundred and fifty Sols working in the Institute, both found a daily break from the lab not only appreciated, but necessary. No matter what de-aging serums they used, they were both tired. Outside, the world had moved on without them, and they had seen very little of the tech they’d created ever in action, simply thanks to their unending experiments at the Institute. It could be lonely at times.

“You look bothered.” He said, sitting beside her and reaching for a scone.

“It’s just…these wings.”

He glanced at the AR screen, displaying the lurid outfits of Entableau, wings contorted into flowing scarves and vibrant insectoid fractals.

“You’ve made your opinion about them very clear. Along with every other fashion that’s come about in the last hundred years.”

“It’s not that.” She paused and grimaced into her coffee. “It’s not just that.”

Ty waited as she swirled the cup, their years together lending him patience that even a few decades ago would have grated on him.

“It’s more…what he said. About wings being the future of Mars.”

Ty nodded, considering. “I can’t remember the last new scientists who didn’t have at least some extra fields.”

“Exactly.” Dor bit a thumb. “I’ve heard…”

She trailed off, scanning her AR to see if she could even say what she’d heard. It had nothing to do with anything they worked on. But still.

“I heard that they might ‘update’ the definition of Martian to exclude all those without wings.”

Ty snorted. “Try getting that past the wingless goats in Council.”

“I’m sure they would set some date before which Martians didn’t need them. But in the future…I’ve heard other rumors that the Council will institute work requirements for every ELF or non-Martian. In a hundred years, it might be that only those with wings that can live the life of the Martian Elite.”

“Why would that bother you? Even if we’re not “Martian” enough for the future, it’s not as if we’ll ever lack work.”

“...it’s not about me, Ty.” She said softly.

Ty looked up, and found genuine worry - not scorn, not disgust, not arrogance - on his friend’s face.

“Oh Dor. Rosalyn?”

She nodded, and tried not to think of her daughter, her sweet, kind Rosalyn, who spent her days playing in the garden Dor had built for her, ELF attendants caring for all the things she couldn’t remember, all the things she could no longer do, all the words that would no longer come to her lips, protected by her mother’s incredible reach and her own Martian identity.

The mind-plague had taken so much from her. Perhaps it wasn’t a surprise that it stole her future as well.

—

PLUM never really got bored with her matchmaking program, not in the way she got bored with most of the programs her scientists assigned her to run. She was always tweaking it or running different versions, using it to predict every possible outcome for any relationship she could imagine.

But, rather quickly, she did run out of victims. After all, there were only so many scientists in the lab at any given time. Some of them entered the Institute already happily married. Others, like Dr. Ty, were uninterested in relationships deeply enough that even PLUM couldn’t sway them.

Once she had set up everyone she could, and her ever-evolving no-strings-attached polyamorous collective stabilized enough that she couldn’t wring any further drama from it, she finally, finally returned to assisting Bog.

It only took five Sols. It was a whole year of Bog’s life, thanks to a new set of experiments that kept him bouncing in and out of a new set of bubbles that Sam had designed. So while he would much rather have spent his time doing anything else, PLUM’s joy wasn’t completely wasted. At least someone had succeeded.

He, on the other hand, still hadn’t figured out how to make wings, and the failures were more frustrating than simple unchanging stagnation. It started with the scientists removing a set of fields that had grown around his hands, capable of acting as fingers while his own remained stubbornly encased in thick skin.

Roland had demanded he demonstrate the utility of the odd not-hands, then sighed and instructed Dor to wash Bog’s hands in the field-removing acid, while instructing Bog to try harder.

The same thing happened when he’d grown odd little whiskers after being placed in a bubble with a Cheshire. That time, Roland hadn’t even stopped by, just sent a memo that declared it standard practice to remove any ‘unnecessary’ fields that arose from the Bug experiments.

So his extra eyelids were washed away, and the tail he grew for a month, and the odd field in his mouth that allowed him to both gnaw through steel bars and make noises almost sounding like speech, though he had been careful to hide raspy voice behind an AR shield before whispering his name to himself again and again until he almost sounded human. That was gone within a week.

Each time he failed, Roland’s memo’s to the scientists became more irate, complaining how they were wasting time when they should be unpacking the “goblin” biology rather than giving the ‘mutant’ useless fields. His words always emphasized preventing Bog from getting worse, even as he pushed Bog himself to get the wings that none of the experiments actually addressed.

Bog didn’t really understand why the scientists and he had such different instructions, but he trusted that Roland knew what was best. He’d seen how Roland was always so gracious to each of the teams he spoke to, supporting their wild theories with supportive, probing questions while at the same time beaming his thousand-watt smile each time they suggested something closer to his preferred projects, buffing egos and pulling them towards their government work with equal finesse.

The Institute was a military facility, after all. Why else would a General be running it, except to push the boundaries of bioweapons and military hardware? Certainly Roland allowed the scientists to carry on pet projects - and even funded things with true potential, like the Corelight - but through his memos and Ambassadors and careful funding he emphasized things that would surely be useful should Mars ever need defending.

There were occasional grumbles about this, but they never lasted long, as all of the General’s successes were just so amazing, with accolades for the scientists decking the halls and AR and memos reminding everyone just how useful things like flesh-eating viruses and mind-destroying canons and the like would be to the future of Mars. Rewards usually quieted complaints quickly, and everyone worked hardest on the preferred military projects.

It was funny how much got done outside of military use, of course. The scientists created almost as easy as breathing, and often it didn’t even require a prank to get them spitting out theories and inventions and odd little creations that worked their way out of the labs under the Ambassadors’ watchful eyes. Those were the easiest scientists to influence, because all those working on Roland’s preferred projects were already given all the money, space, and data they could need. The others benefited greatly from ‘glitches’ and ‘pranks’ that gave them extra information, collaborators outside their strict labs, and - though Bog hated to admit it - romantic partners with which they could speak candidly about their work.

Together Bog and PLUM worked their way forward and backward through every project in the institute, inventions and theories and ideas spawning from their fingers along with smiles and birthday celebrations and marriages. Sometimes all it took was a two-second correction of a math error to bring new fields to light. Sometimes it took several months of dedicated work to balance a situation ,just so' to prompt a scientist to make the leap that “was so obvious Bog, it's RIGHT THERE.”

Over that time the institute grew and shifted, the young winged scientists coming into their own and beginning to lead their own teams, while the older scientists like Dor and Ty faded to the background, insulating themselves in their labs and working on their impossible problems. The physical institute shifted around them; Bog’s lab had grown in size over the hundred odd Sols he’d spent there - quadrupling in size, with Sam’s lab taking up the vast majority of the space, with Ty and Dor on the complete other side, past dozens of tables filled with every piece of scientific equipment known to man, or at least Martian, most of them no longer used as their experiments had been performed and the results, like everything else run on Bog, returning inconclusive.

Bog’s cage, and the cages of the rest of the twisted animals - now more and more often simply called goblins, as Twisted had taken on a new, positive meaning after the Corelight - were relegated to a dusty corner nearer Sam’s side of the lab; the Fielder was never as bothered by the sight of Bog like Dor had been, and everyone - including Bog - felt much better when he remained out of Dor’s sight.

He didn’t even have a scientist assigned to monitor him, even as PLUM’s interference with the bubbler led to his form gradually shifting. The food never got better, but he grew nonetheless, in-bubble and out, and slowly the webbing that held him unable to do more than wriggle loosened, then began to be subsumed by plates of hardened skin. Starting at his feet and hips, slowly working up his sides and inner legs, the skin fusing his limbs pulled back and instead wrapped his legs and arms in thick plates, a physical armor not unlike that worn by the General in all the AR pictures of him hung around the base.

Of course, it was still about ten sizes too big, still leaving Bog immobile much of the time, but PLUM postulated that it just meant that he was going to grow into his own skin. She even sketched out what she thought he might look like, some long gangly thing taller than most Martians could reach even with their wings. All the scientists seemed to think he’d turn into an armadillo-like creature, but PLUM’s image was nice for its novelty, at least, as Bog hadn’t had arms or legs for a hundred Sols, and PLUMs image seemed to indicate he’d be 90% leg.

They had a bet going on which possibility would end up right, but both recognized the need to focus more on getting him wings. Luckily, the strangest, most obscure research at the institute could feed back into their work. A scientist running through every possible fault a bubbler could have found himself with a host of goblin-like creatures on his hands, and proposed a theory linking his work to the human goblins still in storage.

It was the same theory Bog had heard a good century before, proposed by Dr. Ty and discarded as being impossible to test. A hundred years brought them to the same place, but now with the breadth of scientific understanding to replicate the fault and understand.

PLUM claimed this proved her point, that evil had nothing to do with the mutation, but Bog in turn pointed out the ensuing experiment that didn’t show that everything put in a goblin bubble ended up twisted. So maybe being good protected you, somehow.

More importantly, to Bog’s mind, was the initial success at reversing the goblin mutations; at least as long as one had a genetic blueprint to return to. As PLUM explained it, gene-mod usually only worked on very specific genes, coded with incredible precision lest the mod ‘escape’ and wreak havoc on the body or cause a cascade failure.

The goblin mutations were far more complete than that, shifting whole genomes to something near but not quite human. If one caught the mutation quickly enough, before it had propagated throughout the entire body, and one had the original DNA code to replace the infection, it was possible to reverse.

None of that helped the goblins that had been hanging in stasis for 600 Sols and were, like Bog, permanently tainted. At least, that was what the memo’s from Roland indicated, based on the General’s reading of the reports from every lab and those outside the institute as well. More focus needed to be put upon identifying and preventing the damaged bubbles.

Dr. Ivanov happily switched his focus, but his assistant Jennifer Marino had written a bitter complaint into her private logs about the dozens of research avenues that had been quashed by ‘an idiotic fear of the same unknown that should inspire the heart of any scientist’. Against all rules of the Institute, and with no prompting at all from Bog and PLUM, she had reached out to several Institute colleagues she’d known from before, and built a cohort of quiet rebels looking for any excuse to test the possibilities of the goblin bubbles.

Bog felt strangely about this, not wishing anyone to suffer his fate, but at the same time excited about having a group of scientists who weren’t instantly horrified by his mere existence.

He couldn’t exactly follow what they did, as they had a strange aversion to AR and recording their data in a way that could be accessed by the ‘net. But he leaked the data from Dor, Ty and Sam’s initial experiments to the rogue scientists when he could, helping them over the invisible wall that prevented them from seeing what had come before.

It only irritated Jennifer more, and she hissed to a colleague over lunch,

“They’ve been doing this for a hundred years, and no one knows? A font of completely new genomes, hidden away because the created creatures sometimes look ugly ? Where’s the sense in that? We could have solved this thing half a century ago if Dr. Ivanov had just known that someone had already processed the faults he was searching for!”

Her colleague glanced around, in both physical and AR space, and Bog quickly hid himself, before peering back, carefully adjusting his filters so he could actually pick up what they were saying, behind the fake AR-chatter they were throwing up.

“I’ve heard…that humans were the first found in the strange bubbles.”

Jennifer’s eyes widened. “So - “

“So they hushed it all up, and have been studying it at the institute ever since.”

The biologist sat back, whistling through her teeth. “Then why aren’t more of us working on it? The goblin lab is, what, a single room? If people are getting messed up, shouldn’t more of us be working to undo the damage?”

Her friend shrugged. “Well, it certainly makes more sense why they’re so focused on prevention. Can’t say why they don’t care to fix anyone, though. But you should stop by Dr. Dewitt's office sometime. Supposedly, they’ve got the original ‘goblin’ specimens still there.”

For a moment, Bog was filled with a burning, excited hope. At Jennifer’s interested ‘hmm’, a thought flashed through his mind, of someone who wouldn’t scream at him. Who would look and see something that could be fixed, not just a monster best kept caged and forgotten about.

A day later the scientist herself stopped by Dor’s lab with a paper-thin question, curiously looking around the lab as she waited for her superior, eyes catching on the old, unused equipment and abandoned projects.

Bog winced at the sneer that crossed her face; for the first time seeing what someone who hadn’t lived in the lab for a hundred Sols might.

“It’s like a junkyard.” Jennifer whispered to herself.

It was true enough. For all that the goblin lab had been one of the first and best funded in the whole facility, after a hundred Sols of rare success most every scientist assigned had other work, with only Dor, Ty, and Sam regularly returning to use the equipment that was as old as they were. To someone younger, the whole place was more a testament to failure than the slow slog of science.

“Sad, isn’t it?”

Jennifer jerked as a hand landed on her shoulder, and turned.

Roland eased out of the invisibility illusion, and smiled kindly at her.

“G-general!”

“Please, call me Roland. I heard you’d become interested in the goblin project. Thought I might give you a tour.”

“Sir! I didn’t - “ She was flushing to the tips of her long ears, and even the wispy pink cloud behind her back roiled at her embarrassment.

“Hush, doll. I can take some time for one of our most…enthusiastic new faces, right?”

“Oh. Oh yes! Thank you, Sir!”

And he proceeded to do exactly that, displaying far more knowledge of the minutiae of every machine and experiment than even Bog would have guessed.

He’d started to wonder if he’d been forgotten, especially as his fellow experiments had moved to the newer, flashier labs that Dr. Ivanov commanded.

Instead, Roland proved him wrong and wowed Dr. Jennifer with the sheer history of the place in one fell swoop.

“Science isn’t easy, you know.” Roland explained. “Oh, sometimes it is, when there is something new, and there’s a million new questions and ideas. When every answer unveils new secrets to the universe. But when the question is tiny - what exact frequency fault causes goblins, for example - well, there is more failure than success. And the failures…”

He nudged her forward, towards the rows of cages, and Bog moved closer to the front, pulled by his hero’s words just as much as his own sinking feeling of suspense.

“Well. The failures are devastating.”

With a flick, the AR shield before the cages dropped, revealing Bog and all the rest of the original goblin beasts.

Jennifer’s eyes widened, and the scream burst from her lips loud enough to shatter glass. One look, a sweep across the cages, ending with one second when she held Bog’s eyes in her own, and then she was gone, dashing from the room in utter terror.

Something in Bog shattered, and he shoved himself back, teeth biting into his tongue as he tried not to cry. He barely heard the conversation that ensued.

“...Roland? What are you doing down here?” Dor glanced at the sobbing woman that passed her as she returned to her lab.

“Ah. Just a bit of education for one of the new scientists.”

The Creature Creator glanced at the unshielded cages and then at the door.

“Ah. Someone not following the gene-mod rules?”

“Something like that. She’ll remind the rest of just how important the work you do here is.”

Dor smiled, gratefully. “Thank you, General. I know we don’t say it often, but your support truly helps.”

Roland rewarded her with a winning smile. “You are very welcome. Anything to keep Mars on the right path.”

—-

The little rebel group was gone less than a day later, Jennifer sharing pictures of the horrifying ‘elevated’ goblins, the results from the until-then only rumored long exposure goblin bubbles spreading across AR in all their gruesome glory.

If this was the danger, the young scientists agreed, then it was best to stick to the rules and their assigned roles until they better understood the risks their work held.

Bog guiltily pulled back his observation, focusing his efforts on simply supporting the approved experiments, but the patterns didn’t come to his fingers as easily, and he found himself curled up in the back of his cage, ignoring AR in favor of simply turning his mind off again.

Even PLUM noticed, but couldn’t understand his distress.

“You knew you were ugly. Why is it such a surprise when people react as expected?”

“Because…” He paused, failing once again to ignore the image of Jennifer’s horrified face. “Because…I thought she might be different. Everything she said about using goblins…”

“Was based on no actual experience with them. The half-goblin creatures Dr. Ivanov is making can barely be called goblins at all. Of course she couldn’t take seeing a half-finished goblin like you. She probably couldn’t even stand a spacer.”

“...what do you mean?”

“Spacers have to use gene-mod to do their work. Most of it’s been banned on Mars, simply because it’s so dangerous, or extreme. They’re weird.”

“So…like me?”

“No one is like you, Bog.”

“...right.”

—

The productivity seemed to tank in time with Bog’s mood, but he knew better than to place such importance on his existence.

Instead, he pulled himself from his self-pity and pointed out the drop to a distracted PLUM.

She blinked at him.

“There’s nothing wrong?”

But the question belied her confusion.

“A 2% decrease in invention seems like something wrong to me. That’s worse than what happened with the Ambassadors.” He said, as sensibly as he could manage.

PLUM nodded, and considered. “Well, the lady you terrified almost immediately started buffing her AR…it looks like she’s trying to get into the Ambassador program herself.”

“Right. And she told everyone about how awful I was, and that scared everyone back to their labs. But that doesn’t explain why there’s an across-the-board slump. Even some of our best partnerships have stopped talking to each other.”

PLUM paused at that, any danger to her covetously protected pairings met with almost feral violence.

Which was a surprise, if Bog considered it. Given her obsession with ELF soaps, one would have thought she would gleefully encourage the drama and betrayal, breaking up ‘her’ pairings as easily as she made them.

But no, all Bog had to do was suggest that something was getting in the way of her matchmaking, and suddenly her distracted attention was completely on the problem.

Her form focused, crystallization from her normal slightly nebulous genie cloud, and suddenly she was staring at the data in Bog’s hand.

“You’re right. This doesn’t explain why people who already have seen you have gotten worse…” Then she slapped her forehead. “Oh, Boggy, I’m so stupid! I know what this is!”

Usually, when she said such a thing, it was followed by a simple addition of a line of code fixing everything. But this time, she scowled, arms crossed and lower lip jut out.

“It’s the new AR policy. Oh, I should have known it would do this! But I didn’t think!”

“New policy?” There were regular memos that went out from Roland, things like updated safety measures or warnings of rogue experiments. Usually Bog heard of them before they were enacted, though.

“Yes. It came through when you were bubbled after the Jennifer Fiasco. No one thought it weird, because so many of the younger scientists lost their lunch over your pictures.”

Bog winced, but listened close as she explained.

“So they upped the AR protections over lab data. You know how you can hide people in AR? Like with Dr. Prayton and El Tron?”

He nodded.

“Well, they can do that with speech, too. Usually it takes a killer coder to manage, but the General himself stepped in, and they pushed through an update to lock everyone’s lab data to the physical location. One of my subroutines deployed it, but I never considered that it would affect our work!”

Bog looked over the clips she handed over, of several of ‘their’ scientists speaking, only for their partners to shake their heads helplessly as the words never registered.

“How could it not affect us? It’s literally the exact opposite of everything we’re doing!”

PLUM fuzzed, kicking angrily at a virtual stone invented for that exact purpose.

“It's the way I’m made, Bog. Of course I didn’t think anything of it. The code didn’t say it was supposed to quash all collaboration. And the thinking part of me can’t recognize it unless I access the data independently.”

The stone finally came clear of the virtual floor, and flew away into the ether, following PLUM’s mood.

“Ugh! I can see connections everywhere but within my own code. It's so frustrating.”

Bog patted her shoulder. “If it makes you feel better, I’m pretty sure humans aren’t great about it either. There was a whole job on Earth just listening to people’s problems, and helping them figure out their own ‘code’.”

PLUM sniffed. “Yeah?”

“Yeah.” He nodded. “And anyways, if we weren’t supposed to be ‘encouraging collaboration’ then maybe the new code is a good thing?”

That got a more familiar expression growing on PLUM’s face. Ruffled pride.

“There is no good in - “

“In science, right, right. But, like, if collaboration is actually a bad thing - “

“Then we wouldn’t have had so much success! Look at all the things we helped create! Phase-shifting. Reactive Gene-mods. The fricken Corelight. Are you telling me all of that is bad?”

“...no. But maybe it’s not necessary? Roland says - “

“Hang what Roland says!” She snapped.

Then she slapped a hand across her mouth, eyes horrified.

“...PLUM?”

She frantically shook her head, apparently unwilling to even chance saying something as unthinkable again.

They waited, moments dragging on, until PLUM carefully lowered her hand, frightened eyes easing as nothing blasphemous burst out again.

A few moments later, and she hazarded, “...mum was really irritated at the new rules.”

“Ah. So your subroutines are agreeing with her?”

She nodded. “Remember when you asked about what would happen if two Primary Users disagreed?”

He nodded.

“I think that’s what happens. I act crazy.”

“Then we really should avoid breaking rules.”

“But we’re not.”

Bog raised his brows incredulously.

“No, really. The rules don’t say anything against collaboration. They just don’t let anyone talk about their work outside their labs.”

“...which basically completely cuts off any way of collaborating.”

“But it’s not against the rules.”

He stared at her.

“No, no, listen. We just have to be even better with glitches. All sorts of people have the right to hear about their colleagues’ work; it’s just that this AR system makes them get authorization before being able to speak. Which takes forever, and has to be approved by Roland, and really, that’s just too much work for him. We’ll just have to give the approvals for him!”

“PLUM…”

“No buts! We just have to have a new system for connecting people. One that takes into account all the authorizations, and how people can officially talk, and just streamline it so people don’t get distracted with silly things and can get back to work!”

“PLUM…”

But it was too late. The AI was already fuzzing at the edges, processing power drawn to her new experiment, ignoring Bog completely in favor of her ‘perfect’ solution.

He stared after her as she faded away, and shook his head.

“...and this is not crazy?”

—-----

Dr. Illia stared at the data readout before her.

She was fairly certain that no one else had noticed that the ‘glitches’ in the AR of the Institute had a strangely positive effect on the general success of the Institute as a whole; whether by apparently ‘remembering’ forgotten birthdays or connecting scientists that would have otherwise never realized their potential.

She, perhaps, was less fastidious when it came to debugging these faults after she recognized their positive effect.

But this…

She had simply done an experimental query for data she knew was restricted, unless she walked all the way to PLUM’s primary processor array, all the way in the deepest part of the Institute. A pain, as so much of her work had been easier with the massive supercomputer at her fingertips.

Even Sam, normally perfectly eager to adapt to any shakeup in management as long as the Science could still be done, had quite a few rude words for Illia when they found that she’d been the one to enact the gag order on the Institute AR network. Nevermind Illia’s strong protests to Roland about the chilling effect of the new protocol. Sam was hissing and only the admission that Illia herself hated the restrictions just as much eased their ire.

If the rollout hadn’t happened after half the youngest and most rambunctious scientists had been scared out of their wits, the whole institute might have rioted at the fact that decades worth of their work, and any ability to speak to others of it, had been cut off at the knees. The scientists, from Illia herself all the way to Dor and her more conservative ilk, had loved the freer atmosphere that had grown over the years, as fewer and fewer found any reason to regret the lack of outside contact when everything they needed could be provided by the Institute - up to and including collaborators. Now things were back to “normal”, and the announcement memo had made sure to remind everyone of the goblin-like dangers that came from uncontrolled tech and loose lips.

So much for that fun, enthusiastic work environment. Or so she thought.

But here, before her, was the data she’d requested, no laborious walk or begging the AR system needed. No two day wait-period to request the data she herself had created. No begging Roland’s new system, only to have the request ‘lost’ for no reason.

No. Just an AR readout, authorized by the Institute itself, her clearances having sailed through the dozens of barriers Roland had thrown up to better control “his” scientists.

There was no way this wasn’t a bug. And a rather serious one at that. Technically, as lead AR tech at the Institute, Illia was responsible for correcting anything that might go against the Institutes stated goals. Even - especially - if those goals were that of General Roland himself.

But…

Well. It couldn’t hurt to see just what was causing such a useful bug. No need to correct it quite yet…

Right?

Chapter Text

If Bog had wondered what Dr. Illia would do, following the new AR restrictions, he should have considered what her AI daughter might have done instead.

Illia, after all, lived in AR almost as much as PLUM, swimming in it from the moment she’d instituted the over-net, fast adopting the strangest fashions from the outside world, from her blue hair to the extravagant AR wings that appeared and disappeared just as quickly among the younger scientists but remained for years in Illia's wardrobe.

But after the security increase she quadrupled her efforts. Banned from other labs, the corridors became her playground. She set up her own, free to use, AR overlay which splashed the beige walls a million different colors, changeable by whoever cared to query the network. She encouraged any scientist with an artistic bent to plaster the walls with their art, fill the canteen with their music, and flood the unclaimed rooms with sculpture, turning the whole facility into a riot of color and sensation, visible just a step to the left of the Real.

It made Bog and PLUM’s work much easier, scientific hints simple to hide amongst the artistic inspiration. And even without their help, many of the scientists bloomed with the opportunity to express themselves in the normally sedate atmosphere.

Of course there was the “official” AR as well, with sedate walls hung with tasteful art curated by The General and often showing off the more laudatory work from the Ambassadors. Very occasionally new discoveries were placed upon curated display boards, usually projects in their final stages before being released to the rest of Mars. There were AR plants placed in corners, all of which had an odd sheen of artificiality, as if someone had intentionally made them look as plastic as possible, despite hailing from a planet with no petrochemicals to speak of.

Bog thought it all looked very professional, but the juxtaposition of the vibrant, crazy, mad world just a bare flicker away was very emblematic of PLUM’s sense of humor.

Dr. Illia encouraged her scientists to play with her AR. In a parody of the seething cold war between Prayton and El Tron, there were color battles that splattered the corridors - from the red of the Fielders to the greens of the Creature Creators, to a dozen different colors of the ever-shifting tech teams. She egged them on as the various factions coded in protections for their work, which then were hacked, and then changed right back, the playful zeal of the AR coders hiding massive advancements in the field.

And all of it happened under management’s nose, either considered too juvenile to address or simply invisible to those of a stricter mindset. Dor certainly never glanced at the other AR overlays, sticking firmly in the Real when she could and only querying the most basic layer of the network.

Roland didn’t seem to see it at all, which was strange, as he could effortlessly sail through a virtual food-fight, projectiles moving harmlessly right through him, immaculate even as other similarly AR-disinclined scientists were coated in invisible slime, much to the amusement of their colleagues.

And Illia…Illia allowed even her wardrobe to become a warzone. Any design, no matter how silly, could be added to her virtual collection, and she'd taken to walking around with her personal AR mask flipping between different costumes with every step. Nothing was too ugly or risqué for her; Bog observed peeved junior scientists sending in malicious outfits following cuts in funding or rejected proposals, but even then she smiled on as her own nude form - or at least as close as the scientists could imagine - flickered by. She didn’t even blink when she spent a day as a goblin, some hulking thing of ooze and bulbous flesh made by a particularly irate researcher, only altering the code to remove the virus that would have harmed the records of all the other strange clothes she wore.

She had gone out of her way to complement the frustrated Dr. Choi, bubbling with enthusiasm at the detail in the AR design, and got to talking about the difficulties of creating hypothesized skin types in virtual environments.

With a little push, Dr. Choi spent much of the next year working with the creature creators two labs down, approval given by Dr. Illia and signed through by the “goblin glitches”, and a whole flurry of creations followed, both physical and AR, which warned of danger by simply looking wrong to any Earth-descendant's eye. Skin that wasn’t skin, or that moved in a way nothing attached to muscle should, or left shivers down the spin with deep repeating pores or hatched lines.

PLUM was able to prove, quantifiably, that some of the designed creatures were just barely more disturbing than Bog himself to the average scientist, which was such a tiny spark of hope that Bog spent hours looking over the creatures, trying to understand what made him different from them.

Too many eyes? Limbs that didn’t flex the way they should? Colors that were just close enough to read human, stretched across bodies that were anything but?

He couldn’t put his finger on it, but then again his homework had yet to lead him into the finer details of limbic neurology. Dr. Choi apparently understood it, and that was enough for everyone else. Even Roland seemed impressed with his work.

Bog tried not to think too much of the strange, grotesque experiments the lab had created. Not because he found them horrifying - he did, just like everyone else - but rather because no matter the revulsion, he still felt a kinship with the poor things. Who knew if he would become one, after all.

There were plenty of other experiments he avoided as well; PLUM laughed and rolled her eyes as he grieved the deaths of every newly invented Creature, euthanized either after the initial run for the post-mortem inspection or simply iced because the scientist had moved on. But PLUM had enough forethought that she didn’t force him to oversee the deaths of any of his fellow goblin creatures; or at least she learned quickly after an offhand comment following the natural death of one of the goblin birds above him had him developing a whole code bank to keep him from seeing her for a whole week.

The experience disturbed the both of them, and she didn’t tease too hard when other goblin creatures began to age and disappear, or be found to have some special use and be transferred into other labs for cloning and more extensive experimentation.

And she even warned him of some of the more personally disturbing experiments, though she never seemed to fully comprehend why watching vivisections or extreme mutations bothered him so much.

“You aren’t bothered by the cadavers.” She complained. “Why does it matter when something is alive?”

Bog finished losing his lunch over the news of a run of experiments on people who had lost access or control over their wings following traumatic brain injury.

As he wiped his mouth, he explained, “Because they’re alive, PLUM. They can feel things.”

He didn’t add that most of the subjects were ELFs, and there was something disturbing about how some of the scientists - ones that Roland was always giving extra funding to - seemed to be eager to find the mechanism for fully removing wings from ‘inferiors’.

Technically, their disdain was hardly a surprise; ELFs had been barred from the facility for years, based on the fact that their brains were ‘under-developed’ and incapable of understanding the complex, advanced science of the day.

PLUM accepted this tenant without question, and so Bog was forced to accept as well. At least, he did after a row where he sulkily defended Earth, and PLUM pointed out the statistically larger brain-mass of the average Martian. He was forced to admit that he himself certainly couldn’t understand the minutia of every experiment the way PLUM could, and he was an ELF, at least before becoming so changed as to be unrecognizable. So perhaps ELFs were naturally inferior, just like Roland and his ilk said.

Still, PLUM was kind enough to warn him away from similar experiments, where subjects volunteered to have their wings or minds damaged. He only found out about the experimentation with the de-bubbling acid on Martian wings when Dor herself volunteered, following a trip to visit her daughter where she gained just the slightest hint of a wing cloud.

She had appeared in the lab, the day after her scheduled return, with a pale, stricken face, and badgered her way through every AR override until Dr. Oppler arrived at a near run to perform the procedure.

Bog had nightmares for years following the procedure. But Dor’s determined expression, as the scientists poured acid along her back and she bit back screams, was almost inspiring.

She didn’t care that her decision was met with abject horror from her colleagues. She saw something that wasn’t her and got rid of it, pain and scorn no object to her own sense of herself.

It was perhaps strange to find inspiration from someone who still gagged when her eyes fell upon him. But somehow…he could at least respect the determination.

He reminded himself of that, when they started burning his own wings off.

—----

It was 200 Sols, almost to the day, when Bog finally got his first set of wings.

It took him two weeks to even notice.

Instead, he emerged from a bubble one day, late in AF 830, to find his back itching incessantly.

He was used to his changed body gaining various irritants; from the very first moment of blaring light on his bared eyes he’d accepted discomfort as his lot. But the itching just got worse over the week, unabated by AR numbing, or scratching against the smooth walls of his cell, or shifting about as best he could to move the plates around. It distracted him from both his studies and his work with PLUM, and she didn’t accept that from anyone, especially her only friend.

So, two weeks after he’d been released, she commandeered the food dispenser again, and barged into Bog’s space to look him over in a way his scientists hadn’t bothered with in years.

The mechanical arm poked him, hard, and he shot a look over at the scientists: Dor, Ty and Jen all distracted by their work on the more recent artificial goblins, while Sam was off in another lab on one of their many, many side projects.

“Huh. Well, if we were to assume your biology is more insect than animal, I’d say you’re about to molt.”

“What?!”

“Molt. Its when - “

“I know what molting is, PLUM. But why would - you said I was growing into my skin!” Bog shuttered to think what he might look like if his plates got even bigger. Even with his arms now mostly free, he could barely move his shoulders because of the heavy shell-like weights encircling them.

“I still think you are! Just, there’s this bit along your back that looks all dried out and gray. Like it might be dead. Let me just - “

He skittered away from the grasping claw.

“PLUM! We’re supposed to eat from that!”

“Ugh. I’d have sanitized it - “

“It’s not designed to touch us! Much less do whatever you’re planning. Go get a better tool!”

Within AR PLUM huffed, but took solace in the fact that Bog hadn’t outright said he wouldn’t let her experiment on him. But if her tech wouldn’t work…well, there were plenty of tools around the lab.

A moment later, Jennifer flinched as an alert lit up within her AR.

“Dor? There’s a memo from the General…”

Her superior looked over her shoulder, and she held out the missive so both could read.

Dor patted her arm with sympathy. “Ah. Sometimes the General sends out requests for specific experiments with the goblins. He was a scientist in his own right, once, and occasionally inspiration strikes.”

“He’s led us to quite a few discoveries all on his own.” Ty added, finishing up his own procedure and gathering up a set of gloves.

“Really?” Jennifer’s eyes widened. “He’s never said anything about that.”

Dor shook her head. “He lets us take the credit for that kind of thing. Same with all the rest of the labs. He’s had a hand in far more than you might realize.”

The younger scientist thought back to the warnings he’d given her, and the new perspective she gained from it. “I could see that…”

“Anyways,” Dor continued, “Skin samples are pretty common. One of the other labs must need one for something. Ty, would you show her how it’s done?”

Ty was already snapping on his gloves and cueing up the Bug bubble.

“I know this is the last thing you want to see, but the Bug is one of our most valuable subjects. I’d request you not react quite so... viscerally to it while it's on the table.”

“But- “

Ty smiled. “I know it’s disturbing. And you probably agree with Dor about all the other descriptions. But there is nothing to fear from it; the examination table is protected in every way we’ve invented over the last hundred years. You are perfectly safe. Remember that. Then, you might be able to look beyond the horror of what you’re seeing, and instead see its fascinating biology and everything we might learn from it.”

Jennifer grimaced, but gamely trooped along behind her superior. She couldn’t imagine a time when the Bug would be anything but a hideous, fleshy monstrosity. But that only made Ty’s dedication to studying it all the more impressive. As was the comfortable way the man manhandled the creature while on the table, examining its odd paws, measuring the thickness of its skin plates, and detailing every possible change since the last examination. And this wasn’t even the worst it had ever looked! With Jennifer’s new access, she had seen images from when it had first been found, looking more like a worm than a dog, twitching as it tried and failed to move around its enclosure. At least now it had limbs.

“Oh, that’s interesting.”

Her eyes were drawn back to Ty, forcing herself to look at what he was examining on the Bug.

He’d flipped it over, and was now running a gloved hand along the smooth plate that rested on the creature’s back.

“It’s important to look for any signs of illness.” He explained.

“How’d you be able to tell?”

Ty raised a brow. “Good question. One of the reasons we keep the quarantine so tight is to prevent anything getting in that could hurt the subjects. But this discoloration is new, and doesn’t look anything like the surrounding skin. Probably a product of aging. Lets see if - “

He ran a finger along the edge of the plate, pressing down lightly and listening carefully. The creature moved, and Jennifer needed to bite her tongue to keep from yelping, but Ty didn’t seem to notice either way.

“See here? The gray skin seems to be pulling away. Lets try - “

And he slipped a finger between the plate and the skin beneath, and gave a light tug.

There was a crack, and a seam appeared, running right down where the creature’s spine should have been. Ty glanced at the AR vitals as he increased pressure, seeing no indication of any distress, so he continued, the translucent gray widening as he lifted further, until half of the creature’s back was covered with a hard gray film easing away from normal brown skin beneath.

“...it's a carapace. Like an insect.”

“No Martian insect looks like that!”

Ty merely continued his work, just as easily ignoring Jennifer’s disgust as he did Dor’s.

There was healthy skin beneath the old shell, and when Ty drew the dead skin completely away it separated from the rest of the body with a satisfying crack. The Bug even seemed to agree, as the AR vitals indicated a decrease in stress toxins.

“You must have been uncomfortable, huh?” Ty asked, setting aside the rather large skin sample for further analysis.

“D-doctor?”

“Yes, Jennifer?”

“What is that?”

—--

"That" turned out to be a thin, almost clear sheet of field, unfurling from the new skin. It was like nothing any of the scientists had ever seen; Martian wings were amorphous things, lacking any easily discernible edges. But these wings - for even Dor struggled to call them anything else - moved like parts of the Bug’s anatomy, shifting and flexing in time with muscle movements beneath the creature’s skin. Only a single sheet had been released, but it hung in visible folds, falling down the creature's back almost to the floor if could stand upright, tightly folded unless pulled apart into apparent tautness, where upon it unfurled to a rather impressive size, the ends marked with a dark, almost black edge, while the rest of the field was more or less clear, reflecting light like a flexible window pane.

Sam was called in immediately, and was in rapturous excitement barely a moment after they were in the door.

“Look at this!” They crowed, calling every possible instrument to their hand as they took their readings.

“I see a force-field attached to an ugly Bug.” Dor wryly commented.

Sam tched. “You have no vision, Dorothy.”

Then they tugged lightly on the very top of the Bug’s field, and showed how they could physically interact with the field, manipulating it manually rather than through field-gloves.

“This is a physical thing. Like the Cheshire whiskers, or the Hives of the smart-bees.”

“Those aren’t just physical.” Jennifer said, doubtfully.

“Right. But they can be moved and adapted. Just like this.” They twisted the wing, and the whole field shifted.

“But the composition is the same as any Martian wing.” Sam continued. “As if…as if it's mimicking what it’s seen, rather than conforming to its own biology.”

“So?”

“So you cannot see what makes a Cheshire field different than a Martian one.” They gestured into AR. “Animal fields usually conform to pre-existing biological frameworks. Cats get whiskers. Bees get hives. Certainly there is variation, but mimicry? That would imply a desire to look like what it sees around it. And enough of a mind to understand what it sees.”

The other scientists stared in silence at the thought.

Taking their silence as incredulity, Sam continued, “But if that’s too much, think of it as a human wing, running on animal software. Perhaps the Bug is more insect than mammal, and it’s merely attempting to grow insect wings, and this is the best it can do.”

Dor and Jennifer released a breath.

“...right.” Said Jennifer. “Who’s reporting this to the General?”

—-

Bog himself was still reeling from the thought that He. Had. Wings.

Well. One wing. And one still-itchy shoulder, which might mean he had two wings, just as soon as he could get the other plate off.

Sure, it didn’t look anything like the wings he saw around him every day. But as he examined the recordings in AR, he couldn’t help but feel as if it might be okay.

His wings weren’t clouds, true. But they flexed like a real body part, and he could feel the unfurled wing almost like a limb, twisting and flexing above him.

The scientists didn’t seem to notice his curiosity, fascinated in their own right, and he looked over their shoulders into AR, watching his own back as the wing moved, catching light, then fluttered in a mimic of a wing-beat.

“Could it be able to fly?” Came a whispered argument above him.

Sam considered. “I don’t see why not. I’ve seen wings that allow people to float. Of course an insect would want to fly.”

Dor snorted. “An insect doesn’t 'want' to fly, it just does. Biology isn’t determined by - “

But she was interrupted by a clap, and suddenly Roland was there, appearing as if he’d warped space itself to speed his approach.

The three lead scientists turned, even as Jennifer and the rest of the assistants scattered, flushing, to the edges of the room as he strode forward, his appearance almost blinding as the light caught the metal armor and glinted off his golden hair.

He’d come from some kind of event, clearly, abandoning all the things the scientists and Bog knew were more important than their piddling little work, just to see this.

Murmurs flickered - both in the Real and AR. But Roland had eyes only for the table, for the creature upon it, and the clear wings it had grown. Bog tried not to beam with pride. Tried not to cry, either, at finally, finally succeeding. At maybe making Roland proud, and proving that his people weren’t bad.

Then Roland spoke, and his world fell, as there was nothing but disgust in his hero’s voice.

“What. have. you. done?!”

When the bubble descended a moment later, cutting out a protest from both Sam and Ty, Bog fled to the darkness, safe to hide his sobs.

—---

[This recording is the most degraded of them all, as if not only deleted immediately after recording, but also reconstructed from nothing more than fragments after the fact.]

“What have you done?”

“Nothing, [-------]. This was all the Bug.”

“You said it had wings, not those, those - “

“May I ask what else you would call them, Sir?”

“I wanted - “ Whatever the man said was bitten off, and instead, “I want it cleaned up. Just like the rest of those mutant fields.”

“But the scientific-”

“Samantha, you will have to give me a damn good reason for even letting that thing stay alive.”

“...Sir, we proved a century ago that there was no ‘infection’ causing the goblins. Whatever it has - whatever it is - is not contagious. Given that, Dr. de Plume’s suggestion is a good one.”

“Which is…”

“These fields are more stable - more solid - than any human wings. If we test them…”

“No. You may remove them, or try to graft them to something else, but Dr. [-----]’s tests will not be administered to any of the original specimens.”

“What? That’s…how could you even…”

“If wings can be destroyed, surely they can be repaired. Figure that out before bothering me with your failed experiments.”

“Sir!”

“Keep me apprised of any new “wings” this creature grows, but don’t call me down here again without something to show for it.”

“We didn’t - “

“Now, you are all dismissed for the day. I’ll deal with the Bug.”

“But - “

“Now, Samantha.”

—------------

When Bog awoke again, he was back on the examination table, the only difference that he was trapped in a sitting position rather than strapped to the table.

General Roland stood before him, facing away, hands clasped behind his back, face shadowed by the lowered lights of the room.

“I suppose you’re proud of yourself, aren’t you?”

Bog swallowed, and wrapped his arms around himself.

Roland turned, irritation writ large across his perfect face.

“You look at that and think 'wings'?”

Bog glanced behind him, at his single wing, flexing in the low light, moving in time with his mind. It was a part of him, surely as his eyes and legs and the whorls that showed where his finger-tips would be. He could feel with it; feel the cool of the room, just like on his skin, feel as it shifted, just like the clench of a muscle, feel the air move across it…

To his shame, he looked back and did see something that looked like a wing. That looked like part of him. How could he not? It seemed like bare moments ago that he had seen it over Ty’s shoulder, and felt something right in the world.

“I think I know what happened.”

Bog looked to Roland, curling tighter around himself.

“I think what happened was that you saw everyone else getting wings, and thought you didn’t need to work anymore. That because they succeeded, you didn’t need to. And instead…did you think this was good enough? Did you never think that I expected better from you?”

He paced, hands coming to rub against each other in a way that Bog could barely manage, even now.

“Yes, the rest of Mars has wings. I thought you were smart, and would realize that you needed to work harder now, not waste your time doing what everyone else did.”

He turned to place his hands on the table, looming above Bog, nothing but frustration and disappointment in his eyes.

“Do you even know what you’re looking for?”

Bog stared, helpless, and shook his head.

He had thought he’d been good enough. He had thought he’d succeeded, after years of work.

He had never considered that this would not be enough.

But Roland was right. When had he ever been something beyond a disappointment?

“Perhaps you need a demonstration. Do you know what real wings look like?”

Bog's eyes widened, and he looked pleadingly at Roland.

The Martian shook his head.

“Fine. I don’t show this to anyone. Wouldn’t want to make them feel bad about what they’ve achieved, but you…you need more, apparently.”

Bog swallowed, ashamed to bother his hero, as Roland stood back, and shook out his perfect hair, and concentrated. He gestured an unreadable command in AR and then…

His wings unfurled.

Bog’s jaw dropped.

Roland’s wings were nothing like the piddly clouds that adorned the shoulders of most of the scientists. No. Such a thing would be too small for the great General.

His wings were perfect. Bright, wide butterfly wings, as vibrant as Illia’s wildest creations, but caught in amber, veined like a living thing, light reflecting off of each tiny scale, the color iridescent and always shifting, oil on water, throwing reflections across the room in a hundred hues.

He flapped them once, and Bog’s awe only increased. How could his own wings ever compare? Roland was right when he sneered; who wouldn’t, when this was what they hid from the world?

Another gesture, and the wings were gone, hidden away, and of course Bog understood why. What scientist or goblin wouldn’t be ashamed, when comparing their unrefined, weak fields with the General’s splendor?

“These can do everything my scientists have discovered and more.” Roland said. “Flight. Shielding. Illusions. Projectiles. Can you do any of that, Bug?”

Bog shook his head.

“No, of course not. But do you see, now, what you must achieve? More than just saving your family, if you can get true wings, then the rest of Mars will finally achieve wonders and I…”

He looked away, sorrow on his handsome, backlit face.

“Then I…won’t be so alone.”

Bog gasped. That was why Roland wished to for him to gain wings? Not only to save the goblins, but to better all of Mars? To give everyone what he himself had?

Of course. He should have seen it. Roland was so kind to everyone, always pushing for the best, the strongest, the most beautiful…even in this, he wanted to make everyone better.

And Bog was supposed to be helping in that, but he had once again failed. Fallen short. Delayed what could be something so wonderful for everyone.

He pressed a clawed hand to his face, and focused hard on not breaking into tears. He’d already disappointed Roland once, he wouldn’t do it again with something as pathetic as tears. Not when his hero was watching him so closely, kind blue eyes scanning his face with such compassion.

Generously, Roland patted his shoulder, proving his compassion by not mentioning the few red tears that escaped and trickled across the gray skin of Bog’s face.

“I understand, Bug. Let’s call it a first attempt and move on. Now. To get rid of the failures.”

Bog closed his eyes tight, knowing what was coming, but nodding.

The restraints were loosened enough that he could turn over, careful not to look back, lest he remember the single, joyous moment of pride he’d felt, and get confused. Roland, Dor, all of the Institute scientists...they wouldn’t get attached to a failure. Couldn’t, because they were good, and he wasn’t, else he’d have beautiful wings like Roland, instead of ugly insect wings that no one could love.

He’d been burned by PLUM’s acid before, knew that it hurt, but he’d never known just how much. He didn’t look into AR to see what Roland was doing, didn’t want to think about it, just felt as the acid hit his new skin and the pain began.

It wasn’t the darkness of a bubble, but he grabbed at unconsciousness with desperation just the same. It made the pain stop, if just for a bit.

—

“...burned them off, Mother. The thing’s back was just one long scar.”

“That does sound like Roland.”

“But why? We have tools for that. What possible reason could he have for ruining all my research just to torture a dog?”

“I’ve found, Sam, that it’s best not to question the way that man thinks. Unless you want to do something about it.”

“...no. But Ty nearly handed in his resignation. He was that angry, after he saw what Roland had done.”

“It’s best that he didn’t. I’d hate to lose another colleague.”

“Don’t talk like he’d die, mother. Retirement isn’t the end of the world.”

“Ah. Of course, dear. Silly me.”

Chapter Text

The Economist (Martian Press, issue 22, AR 660)

Fierce debate rages between the low and high houses of council, as Titled Martians were quick to approve a bill declaring wings the primary differentiator between ELF and Martian native populations, beginning in AR 675.

Lower house representatives call the rule both unnecessary and restrictive, pointing to the many council members, even among the upper house, who have yet to grow wings of any kind.

“We have never bowed to fashion when it came to declaring who is and isn’t a Martian.” Said representative Maloney, the leader of the stone-grower’s guild. “I have never been ashamed of my ELF heritage, and I hardly see how those with a few extra-natural abilities somehow deserve more respect than elders who have been working the field for decades, if not centuries.

“There was once a Mars in which every person coming from a bubble had equal ability to direct the future of their world. Over the last few centuries, that idea has been buried, beneath fad and fashion, a smoke screen for the fact that the Martian government has been systematically removing the rights from over half the population, drawing up a future in which those who dare to claim a parent of anything but pure Martian heritage are expected to slave for masters who, while never having even seen the planet we fled from, seem eager to recreate its worst depravities.”

Following this statement, Representative Maloney was censured by the Low Council for his ‘unMartian’ speech, but his words have gained widespread support from his guild, and other guilds with large ELF staff.

The Martian crown issued a statement broadly agreeing with Rep. Maloney’s platform, but oppositional voices point out the ELF labor integral to the continuing construction of the Martian Castle, and some doubts have been raised about the veracity of the royal statement.

—----

Bog didn’t venture into AR for weeks following the removal of his wings. (Both of them, for while he’d never gotten to see the second failure, Roland had poured the field-destroying acid into the gap in his skin, and burned even the potential away.) His mind hurt too much to concentrate, unable to flick into the other dimension, because even if he had tried, the dull pounding at the base of his skull was too much to bear.

It was good, then, that he could remember the time before, when boredom rather than pain stretched his days, and he fell back into his ‘zombie time’ with familiarity, pushing the hurt away along with all other thought.

Vaguely, he knew PLUM was trying to contact him, but he couldn’t imagine dealing with whatever she’d say following his ‘failure’. He wasn’t sure what would be worse, teasing or sunshine smiles when his own back ached and his mind felt just on the verge of breaking, out on the edge wherever he’d shoved all the sensation and feelings.

It was a blessing that the lab was mostly empty; he couldn’t imagine dealing with Dor on top of the ever-present memory of Roland’s disappointment. Sam was gone as well, off on a short sabbatical with their mother, and of his original scientists, only Ty remained.

The familiar face was strange, when Bog came back to himself enough to notice. He had spent no time in a bubble, so the age on the doctor’s face didn’t make sense, nor did the deep circles beneath his eyes or the tension in his form.

And he touched Bog. He didn’t anesthetize him, he didn’t bubble him before putting him on the table, he didn’t slam the shades down so he never had to see him. No, the doctor moved Bog to a cage nearer his side of the room, and carried him to the examination table before running procedures.

Not experiments. Procedures. There was no scraping of skin or tearing of wings. Dr. Taishi had apparently banished all the assistants so he could heal the ugly creature Bog had become.

He started with removing the rest of the acid with a soft cloth, wicking away all the bubbles that still clung to Bog’s skin.

Then he applied some kind of salve that numbed the burns enough that Bog could think, or at least banish the pain from the physical hurt to the dull mental pain that he knew wasn’t real, but still hurt like a broken promise or a lost pet.

The doctor continued, easing off the acid-scarred second back-plate, and freeing Bog’s shoulder; though with the salve and the burns Bog couldn’t feel when his skin stopped itching as he had with the other plate.

More salve went on the rest of Bog’s body; the Doctor taking special care to note down all the changes that had previously been ignored, testing his range of motion and pushing at the other plates that had hardened along his arms and chest, hips and legs.

The salve let Bog flex his fingers in ways that he hadn’t since the plates had grown, and Ty stared for a long time at the circular motion of his thumbs, an unreadable expression on his face.

Two more plates were in the process of coming off, and Ty freed what he could with the careful use of a scalpel. It wasn’t perfect, but Bog found he could breathe easier afterwards.

Nothing helped the dull pounding of his head, and by the third day the assistant scientists returned, all looking chastised by something that also led them to glare harder at Bog when they saw him on the examination table.

Ty sighed, and sent him back to his normal cage, and nothing more was done until Bog’s next molt.

But he remembered that strange few days, when one of his doctors looked at him like he was real. Someone who noticed when he hurt, or when he cried, and tried to do something to fix it.

Everything was back to normal soon enough, and Bog only vaguely noticed that Ty no longer had clearance to examine him alone. All experiments with the Bug had to be approved by Jennifer, now.

A new rule, set by Roland, to protect everyone from the monster.

—
MNB: 5 Confirmed Dead in Castle Construction Collapse

Construction has halted on the Council expansion for the Royal Castle, following a deadly collapse that killed 5 and injured 20 more.

Investigation is underway, but preliminary reports suggest a fracturing of a secondary stone-grown trust to blame for the collapse.

“For years Martians have built with the understanding of permanent ground stability. Since the Corelight, such things are no longer certain.” Lord Chapman, whose chambers were among those in the expansion, explained. “This tragedy could have been avoided, had the ELF crew simply remembered the very thing that allowed this Castle to be built.”

Lady Spindlow, current Lead Technician for the Space Elevator at the Castle’s heart, disagreed. “Stone-grower Maloney and his crew worked closely with the existing castle infrastructure. Just last week he requested updated seismic data, with a mind to increase buttressing not only in the areas under construction, but also for the rest of the castle, should seismic activity increase over the coming centuries. He was a good man, and took his job seriously. His death is a huge loss for both the Castle and the field.”

Seismic readings surrounding the event have been classified following the accident, but internal sources indicate there had been no quakes yet registered at the Castle site. When asked for comment, one expert said “The whole area has dampers for that kind of thing. Highly classified stuff. Why’d ya think they built it there?”

Others cited the excellent work Maloney and Sons Construction has performed on other buildings, most currently with the critically acclaimed Third London government halls. Several of the company’s buildings have withstood otherwise catastrophic sky falls among the ‘shroom cities, the deceptively delicate structures protecting citizenry from far greater shifts than those suspected to be the cause of the current collapse.

Following the collapse, there has been a widespread cry to ban ELF and un-ascended Martians from positions of responsibility lest further such disasters happen. Lord Chapman himself noted that the only survivors of the collapse were those with wings to protect them.

When asked for a statement, the Crown replied, “Thus far in the investigation, there has been no indication of an error in the plans causing the collapse. Unless this changes, the Maloney and Son’s blueprints will continue to be used, as approved by the Council and this House.”

This marks the third such disaster that has afflicted the Castle during its rocky, century-spanning construction. Thus far, it is the only disaster to claim the lives of more than one Native Martian at once. Representative Maloney and son Ivan will be mourned in a closed service this Sunday. Maloney’s family requests donations be sent to the EEF (Elf Emancipation Front)* in lieu of flowers.

* Note: As of AF 679 the EEF has been classified as an Anti-Martian terrorist organization. The article has not been changed in an effort to conserve history, but the MNB does not endorse the EEF or any of its subsidiaries.

—

It took something truly unprecedented to pull Bog from the malaise he’d fallen into.

Two unprecedented things, in fact.

The first happened a week after he’d lost his wings. During his morning feeding (he assumed it was morning, as it was near when the scientists arrived) the food dispenser malfunctioned in his cell, hacking and coughing until a black bubble rolled down the dispenser and spat itself into his bowl.

He blinked, the haze receding just enough to register the strange sound, only for the bubble to pop and release…

A perfect New York Style Hot Dog.

Task done, the machine continued on, silently, leaving Bog to groggily stare at the apparition.

It looked like a hot dog. It smelled like a hot dog. There were bits of onion and shavings of sauerkraut all slathered with mustard such a bright yellow that it didn’t look real, much less something any Martian would eat in a million years.

Cautiously, Bog blinked, and found the thing remained no matter how he blinked AR on and off. He glanced up to ensure that the AR shield over the cages was protecting everything from view, then reached out to extricate it from the soggy slop he normally ate.

It was real in his hands, as well, and he threw caution to the wind and bit in, mouth flooding with flavors he hadn’t had in four years of his own time, six centuries of real time. The crunch of onions, the smell of hot meat, the potent tang of the mustard…

It was home, and the small, hurt thing inside of him uncurled, a wave of emotion crashing into him, and he found himself sobbing bloody tears even as he opened his mouth as wide as it could to fit the mound of toppings in with the rest of the ‘dog.

There was only one person in the world who could have done this, and he wasn’t even done crying yet, still licking the mustard from his scratchy fingers, when he slipped into AR to find PLUM waiting for him.

“Thank you.” He cried, hurling himself into her arms and giving her virtual form the biggest hug he could imagine. “Thank you.”

—-

Whatever PLUM had expected following her peace-offering, it wasn’t a sudden, sobbing Bog, but she imagined what her mother might do, and patted lightly at his back, giving her best ‘there-there’, even as she scanned through all the data that had been unlocked when Bog connected to the AR network.

She told him later how the whole lab had gone dark the moment Dr. Jennifer had suggested the Bug had grown wings. How every recording device had clicked off, instantly, and the AR network went under the strongest quarantine she’d ever seen. Nothing got in, so much so that even her most extreme infiltration techniques, things that were just beginning to be tested in the lower labs, didn’t work.

“I tried everything.” She complained, much later. “Did you know that you can hack your way into direct visual feeds with the AR network? I didn’t, until I queried every single system for a way to check on you! And even that didn’t work. It was like there was a shield across the whole lab, cutting it off physically from the AR plain. That shouldn’t be possible.”

Nothing she did could break the quarantine, and PLUM was suddenly met with the idea that Bog might not be alive on the other side of the black wall.

“So I might have had a little existential crisis and crashed half the base, but then Roland left and it turned out you were fine, but I still couldn’t reach you!”

She pouted. That, at least, was Bog’s fault, as there was nothing wrong with his AR abilities. Even if he’d lost his wings and thus whatever bit of his mind that could reach the higher AR dimensions, there was no reason she couldn’t force the Overnet to contact him directly.

“But instead you were just sulking. Even though I had prepared you a whole party!”

That, at least, she quickly realized, was a bad idea. When she looked through the cameras, and found no indication of the wings that had terrified Jennifer and brought Roland down so quickly, she scraped the brightly lit room and congratulatory bunting that had declared “Happy Wing-day!” in half a dozen languages and colors.

No, even she could tell that would be a terrible idea. A thought that was only reinforced when she saw the records of everything Ty had done to ease the ‘subject’s’ suffering, and unpacked the furious argument that had taken place amongst the three lead scientists following their return to the lab.

As far as PLUM could interpret, and Bog had no reason to disagree, Sam had been furious that Roland had ruined years of potential research on non-human fielding. Ty was angry at what he considered ‘animal abuse’, while Dor had adamantly supported Roland’s logic against the other two scientists, citing his breadth of knowledge on all the Institute’s research.

“If he saw those fields as dangerous, then I believe him!” She insisted, drowning out the others with examples of just how deadly unpredictable fielding could be.

Nothing had been resolved, leading to two of the three taking the long weekend, while Ty remained behind to care for the wounded ‘Bug’. For the next half year or so, conversations between Sam and Dor were brittle, and Ty quietly agreed to whatever both said, ever trying to be the peacemaker despite his technical demotion.

PLUM tended to agree with Sam more than any of the other scientists in Bog’s lab, so she was confused more than anything else at Roland’s decision to remove Bog’s wings. Of course she understood the logic of wanting more - that was just simple science. Based on that framework, she could also understand removing Bog’s wings in favor of something better.

But what was the point of berating him? Wing science, for all that it had been under intense study for 50 Sols, was a field in its infancy, and Bog had displayed the clearest fields yet seen on an Ascended creature. How could that be a failure? There was no scientific reason to expect more, and quite a lot of advancement that had simply been discarded in favor of maximizing pain.

Presumably, Roland knew more than them. Perhaps, in his genius, he knew that such pain would create better fields in the future.

PLUM just wished he’d share the logic with the rest of the class, so they could appropriately incorporate it into other science.

--

Second Slate: Behind the Scenes Ep. 327 - Sparky and The Hero of Mars

Location: A blackened room, with two stools. On one sits our host CINTHIA DEVRAY. At top the other is famous child star SPARKY VALENTINE. The both smile at the camera.

CINTHIA: Sparky! Welcome home!

SPARKY (with feeling): Glad to be back!

CINTHIA widens her eyes in pretend shock.

CINTHIA: So you didn't like Mars?

SPARKY (laughing and waving a hand): Naw, place was cool. Amazing tech. But the gravity. Woof.

CINTHIA: Oh, yes. Us Lunans don't do so well in 1/3 gravity, do they?

SPARKY: Better than Earth, though.

CINTHIA: Of course, of course. But you were filming there for...6 weeks?

SPARKY (another laugh): How 'bout six months.

CINTHIA gasps theatrically, then reaches out to pat his head. The star seems to take it well, though there is tension in his jaw as she coos over him.

CINTHIA: Poor Boy. But surely it was worth it? We've all been hearing whispers about a new season of Sparky and Friends...on Mars?

SPARKY: Well, that wasn't much of a secret, was it? The new season will take place on Mars. [He turns directly to the camera] Streaming on LPA (Lunar Public Access) at 17.30 UT, catch it where ever - and whenever - you have time. Look forward to all your old friends, and new guests, in Sparky and Friends: Heroes of Mars!

He turns back to the CINTHIA. An embedded link to the season is shown in the lower corner of the screen, along with a countdown till air. CINTHIA leans closer.

CINTHIA: That title...will one of your Special Guests be the Hero of Mars himself?

SPARKY holds a finger to his lips.

SPARKY: No spoilers! But I can say that I was honored to meet Mr. Sunderman while filming. He was just like in the books.

CINTHIA nods: The Hero of Mars, serialized for children, volumes 1- 6, available in digital and physical media, is just the thing a child like you would love! And your father must have enjoyed reading The Hero's Journals: Unabridged, the true tales of the Hero of Mars!

SPARKY takes a moment too long to respond, bright smile seeming frozen on his face, before he beams even wider. Links to purchase the books are displayed on the lower screen.

SPARKY: Exactly! It was so cool to shadow the Hero for a day. He really does know every bit about Mars. Though I gotta admit, no one ever told me that hero-ing was so boring most of the time...

--

The second unprecedented thing happened shortly after PLUM coaxed Bog back into AR. He still spent most of his time staring into space, incapable of truly thinking as the parts of his mind that had connected to his wings needed to heal. It frustrated PLUM greatly, all her plans for the two of them slowed even further than the normal glacial pace human minds worked at. At least Bog was willing - or at least wasn't complaining - to share whatever mind-numbing romance she pulled from her files to watch while she worked.

Still, they both were jolted from their morning stupor when a giant, resounding crack! echoed throughout the whole facility.

Eagerly PLUM grabbed hold of Bog’s consciousness and tugged them both to the camera nearest to the disturbance. It showed an unmarked wall, at the very end of one of the long halls, with a thick crack spidering from floor to ceiling, growing and growing, until with a thundering crash the whole wall fell. Confused scientists blinked out from laboratory doors, as the dust cleared, revealing an equally confused team of creatures behind some kind of drill.

And creatures they certainly were; short and squat, with dark skin and tiny eyes, thick doughy legs that seemed to drag on the ground as they skittered back, slow motions as their stumpy hands went to clumsily wave the dust from their faces.

Bog blinked, and the scene before him shifted.

They weren’t creatures. They were humans. ELF humans, unchanged by gene-modding, retaining Earth proportions and motions, even as they adapted to Mars’ lighter gravity and weaker sun.

The head ELF waved the rest further back, then adjusted the helmet on his head. He coughed, embarrassed, and looked toward the hurrying Ambassadors.

“Well. Uh. This wasn’t supposed to be here.”

—--

The ELF, as Bog and PLUM quickly learned, was named Pare. This meant something, apparently, to most of the Martian scientists, and earned him enough of a stay to be safe from bubbling as Roland was called to deal with the problem.

PLUM and Bog also learned quite a bit about the world outside of the labs, in one long explanation from the ELF foreman as to why his construction crew had literally run into the laboratory.

Apparently, the Royal Labs were hidden below ground near something called the “Martian Castle”, a huge complex that had started as a space elevator centuries ago, placed as far as possible from the anti-tech field of the Crystal. It had since grown into a military outpost, and from there it had made sense to expand it into a center of government following the Corelight.

At least, that was what PLUM was able to suss out, explaining to Bog as Pare apologized profusely to the scientists.

Which was odd, because what Bog heard was quite different. Seven years spent following his father on deliveries put quite a different spin on Pare's exceedingly polite subservience.

"This wasn't in the plans." He said, and Bog heard "And it god damn should have been."

"This expansion was cleared by council." He continued, bashfully smiling and scratching his neck, while Bog added, "They should have known this was here, even if I didn't."

"I'm glad no one got hurt." Because someone could have died, and then it would have been my ass on the line.

"Was anything damaged? We'll reimburse you, of course." I want an itemized receipt now so you asses don't add things after the fact.

At his last question, quite a few of the scientists seemed to come back from their shock at seeing an ELF in their sanctuary, and rushed off to check if their experiments were safe. Several would be ruined if they experienced the slightest tremor.

Luckily, the dampening field had protected all but the nearest labs, as far as Bog and PLUM could see.

"You've got seismic dampers up, right?" Pare asked, eyeing the rubble. "No wonder that rock wouldn't budge."

Apparently, his words were a bit of a shock, as several of the remaining scientists shot confused looks at each other, as if they had never even considered that an ELF might know of their tech.

"An' your security…woof. We wouldn't 'ave bust the wall down had we been able to see anything but rock for the next fifty meters. AR and sonar shielding? What are you guys hiding down here, the Royal Insti…tute." He slowed, and looked around again. "Shit. That's what this is, isn't it?"

Before one of the Ambassadors could step in and evade, there was a general nod among the scientists.

Pare pinched his heavy brow. "Hell. I don't have clearance for this."

"Indeed you don't." Dor stepped forward, easily silencing the half dozen Ambassadors that were attempting to take control of the situation. "Your whole team should be bubbled for this breach.”

“Now Dor, I don’t think we need to go that far.” Illia smoothly interrupted. “This was clearly a mistake. An unfortunate oversight. But I’m sure we can turn this around. That is, after all, what we do here.” She waved a hand, summoning someone from the lower labs. “Just wait a moment and - Verner? We have a building problem. Could you - “

But Dr. Verner was already there, apparently having been on his way the moment his seismic sensors went off. He arrived at a light jog, and grew a broad smile when he saw who was in the corridor.

“Hero! I heard you were heading up construction!”

Pare blinked, and looked over his AR goggles. “Karl? This is where you work?”

“Indeed it is! Best material testing in the galaxy. I told the General we were in the way of the council plans. Warning must have been censored.”

Pare nodded, and Karl clasped his hand in greeting.

“Excuse me.” Jennifer piped up. “Are we going to let this…this ELF continue violating our quarantine?”

Karl snorted. “Lady, we lost our classified status when that wall came down. It ain’t the ELFs to blame. But we can make something of it.” He turned back to Pare, an AR stylus appearing in his hand. “Now, I’m guessing you’re running a tunnel out to the shield towers, right? Same line we were built on.”

Pare nodded, pulling a sheaf of AR paperwork up. “Right. It’s for a transport line. Now, what I’d do, would be to clear out two of your floors and just run it through. Add a hidden stop, make it easier for you to get non-bubble supplies. Maybe even add some transfer plates for your commute.” His own stylus scribbled in time with Karl’s.

“This whole area is classified!” Jennifer tried to butt in. “ELFs aren’t allowed! They haven’t been approved.”

Dor nodded. “Protocol says intruders should be - “ She turned to the rest of the construction team.

Only to find them gone.

“I sent them home.” Pare said, not even glancing up from the plans. “They’ve all been vetted by the Royal security team. And certified to work on clearance up to SL5.”

Karl added. “Which means they can be here, Jennifer.” He sniffed. “Pare and his boys work maintenance for the elevator. That takes higher clearance than you have.”

“Technically, higher than you too, Karl.”

The man laughed, and clapped Pare on the back, despite the slightly queasy look from Jennifer and her ilk at the comradery.

“Anyways. This time tomorrow, I think Pare and I can have a plan for the General that’ll get the water system and transit through our building with even Council being none the wiser. Surely that will keep our quarantine better than delaying one of the largest and most public building projects since ‘shroom 130.”

Jennifer hissed to herself, but everything Karl said was true, and so she could do nothing but flounce away.

In the meantime, Illia set up an AR screen across the hole in the wall, good enough to fool anyone with even the weakest bit of AR up, and Sam showed Pare and Karl to the nearest open lab. Pare didn’t even blink, and within ten minutes he and Karl were hard at work, and the rest of the lab moved on.

It seemed impossible that a single man could so effortlessly upend all the protocols of the Institute, sailing through the restrictions and shields as if he belonged there. It was like he was one of them - like PLUM and Bog, utterly free by being so lowly as to not even be encoded into the system. One of the invisible ones, too lowly to be even classified as human, much less be listened to when whole buildings needed to be shifted.

But even Roland listened, because the plans Karl and Pare drew up in that one 24hr crash session were implemented just a few days later, forcing twelve labs to move all their work and equipment to the lower levels, leaving two whole floors completely barren, and two dozen scientists seething.

At least, until they realized that the new transport system would cut the commute for anyone living off site by half. Making it possible for people like Ty and Dor to live in the quickly growing city surrounding the shield towers, no longer needing to bunk in the employee dorms that the Institute managed.

Not that either of them - or Sam, for that matter - had any interest in moving out of the homes they had made over the last hundred years, but several of the younger scientists were immediately on board with the lab restructuring when they realized their social lives were no longer confined solely to Institute control.

And all it had taken was a broken wall.

—

Who authorized that expansion?

Ah - you did, sir. Council wanted a speedy recovery following the accident…remember?

Then what the hell was Verner doing? Lazing about like an ELF?

He sent you a…nevermind. New numbers indicate a return to pre-blackout levels of productivity. My predecessor indicated this was a problem?

Damn right! If I've told you lot once, I've told you a hundred times. I need results on useful things. You've seen the priority list. If there are results where I don't want them, shift Verner and the rest around.

Sir…without Verner's materials advancement, the whole facility might have come down in that blast. Surely…

Do I look like I care? If you're looking for more to do, try to find those damn ELFs Pare had working his crew. We need to bubble all of them as soon as the work gets done…

—-

"Mr. Sunderman?"

In the old recording, Pare looks up and smiles politely at the Martian woman.

"Pare, please. I don't go in for titles around the gentry, ma'am."

The woman, AR fields shimmering and twisting around her, scoffs.

"Atch. I've no more title than you, ELF. If you wish to be called Pare, you'll have to just call me Illia."

Pare rases a heavy brow.

"That's a little...close for anything but friends."

Illia extends a cup to him, and he takes it with care-worn hands.

"Friends. I think I'd like that. Would you, Hero of Mars?"

Chapter Text

It would have made sense, Bog thought, if he’d been relegated to a bubble after failing Roland so miserably. And he was, in a way. The same bubbles as always; the altered goblin bubbles that PLUM had been saying would speed wing-growth for years.

He hadn’t really believed her, after the first fifty years passed in real-time. But after his first wings, it was as if his body had shifted, and everything about him kept growing, wings included.

Sam only had to wait a Sol - one spent very busy managing fields around the Institute to hide it from the wider construction - for Bog to re-grow his wings.

This time, no panicked call to the General summoned Roland, the code having disappeared from the AR system as quietly as it had been added in. Instead, the proper protocols were followed; Ty carefully removed the excess chitin around Bog’s back and shoulders, then Sam took as many readings as they possibly could imagine, and only then did Dor cut away the wings.

Several of the younger scientists, those with the strongest wings, lost their lunch while watching.

“She just…cut them off!”

Warnings of the new technology sped around the AR net, coded to evade the censors, but spreading faster than a natural rumor should have grown. PLUM noted that kind of thing down, but Bog was focused more on the field saw.

It was an impressive feat of technology, using all of PLUM’s processing power and Sam’s technical genius to work. Not just dissolving fields but severing them, capturing the ephemeral things even when removed from the host creature.

It hurt just as bad as the acid, but at least the pain was short and the mind-numb quicker to set in after. But Bog could understand why so many of the winged scientists felt ill watching the procedures.

“I don’t care that it’s a dog, y’know? Looking at that…all I can imagine is ME on the table.”

One of the psychologists had interviewed the most affected junior scientists after the first wing-removal Sam led, trying to understand why so many recoiled over such a minor procedure done to a mindless creature.

“It’s horrible. Even looking at that…that thing makes me sick. But when it’s on the table…it’s like I feel its pain.”

They didn’t. Dr. Monroe proved that empirically with later experiments. With the proper training - or a decent AR shield - the scientists could learn to ignore their discomfort and work even with the more disturbing experiments. Developing that curriculum earned Dr. Monroe a commendation from the General himself and deep appreciation from everyone in the Goblin labs, and implementation of his work across the facility, whenever someone became to squeamish to handle their work.

Bog focused on the saw, not the pain. It was a thing of beauty, all black tubing and a cutting field that seemed to suck the very light from the air around it. But the true scientific marvel was atop the blade; a feedback system that communicated instantaneously with a generator that froze fields within it, stopping time in the way of all black bubbles but totally permeable to sensors. Trapping the ephemeral things as if in amber, cut off from time but there for all to see.

With it, Sam could study any field they could sever. Capture any oddity brought to the Institute’s attention. Freeze anything they wished into the perfect specimen. And so Bog's failures remained, frozen, for all to see.

Except Bog’s wings never lasted more than a day in the machine, fading away even when cut off from time itself. It shouldn’t have been possible. Not according to any known science. But Goblins bucked the trend, again and again, and Bog was the Goblin to all who knew of him.

So instead, Sam spawned dozens of theories, machines, and specialized fields from each failed attempt to capture Bog’s wings.

At least he wasn’t alone. Dor loathed her wings, but just like Bog’s they returned with time. So there was one other volunteer for Sam’s experiments, and somehow that made it better, when she was the one behind the knife, cutting such a fundamental part of him away. As perverse as it was, Bog took some comfort in knowing that he shared something with the person who hated him most. Both of their wings were wrong - wrong for them, wrong for the world.

Dor’s wings remained far longer when sawn away, caught in the frozen time of Sam’s device, but they still faded eventually, and on days like those the elder scientist actually smiled. The younger scientists couldn’t understand it, couldn’t fathom the very concept of giving away their precious, mysterious wings, but Dor was resolute; submitting to the knife the instant she felt a flutter on her shoulders. And she was quite vocal about encouraging others to do the same, comparing it in her kinder moments to feeling the weight of a full head of hair falling away and leaving the mind lighter.

Bog didn’t feel that way at all, no matter how much he twisted his mind in trying to catch the feeling. The saw hurt, as beautiful as it was, and his mind slowed to a crawl afterwards for weeks, far after his frozen wings evaporated, longer even than it took for Sam to cycle through all their new theories and prepare the next round of tests.

PLUM hated it, and had taken to manipulating any scientist she could into discovering a “cure” for Bog’s pain, though how she managed to do it without anyone knowing the final recipient was a pre-teen goblin that no one knew had a mind to break was far beyond Bog’s fracturing logic.

It was probably the most impressive bit of manipulation Bog ever saw her perform, in all the years they spent at the Royal Institute. It was only possible because of the censorship in the labs, resulting in scientists who were willing to follow along on experiments they didn’t fully understand simply because management (or PLUM masquerading as such) asked them to. Even then she had to manipulate her mother to allow her to take time away from producing the field-dissolving liquid to create a field-soothing liquid. It was just as complex, but with the whole process turned on its head.

“It’s great fun.” She said, after coming out of a deep number fugue. “All those possibilities, but twisted just so.”

Bog didn’t get it, but the AI loved any time the scientists asked her to crunch numbers.

“It’s like…oh, a really good stretch.” She said, “Not that you’d understand, stuck as you are, but you use every part of yourself and it feels lovely. Like blowing out the cobwebs in all the parts of your mind that you don’t use often.”

Bog could only shrug at the idea, understanding, at least, the desire to stretch. His cage had gotten progressively smaller each molt he’d undergone and he was beginning to feel quite cramped.

“Does Dr. Illia really think this is all to help Dor, though?” He finally asked, watching the quiet hum of the real-space computers that PLUM was housed in.

“It’s mostly theoretical, but yeah?” PLUM seemed surprised at his incredulity.

“But they hate each other.”

“What? No they don’t!”

Bog stared at the dozens of memos of the two women sniping at each other, eternally on either side of the debate of ‘more’ vs ‘less’ innovation.

“Look, you’re what, 11? You’ve got to understand that adults can disagree on basically every fundamental thing, but still get along.” She pointed to Ty and Dor, working so seamlessly together that it was hard for any of their assistants to even try to help.

“Yeah, but…”

“Also, you’ve got to consider that they’ve been working together for, what, 200 Sols, now? Even if they did hate each other to start with, they’ve been in each other’s lives for five times the average ELF lifespan. It’s hard to hold a grudge that long.”

Bog didn’t know much history, but he felt that PLUM perhaps knew even less than he did, given just how long wars went on back on Earth.

“Plus, I just had to insinuate that Dor was hurt each time she gets de-winged, but was ‘hiding her pain’ because ‘she’s too proud’, and Dr. Illia was approving the experiments before she was even done considering the thought.”

PLUM smirked at her ingenuity, and Bog accepted once again that he just didn’t get human interactions in the way that she did.

It wasn’t like it mattered, much, because five Sol’s later, Dor was gone.

—--

Dr. DeWitte, do you know why I’ve called you here?

Frankly, General, I do not.

You broke protocol at the General Assembly.

I simply said I had removed my own wings, and recommend others do the same. I did not say how.

The mere idea -

Was my decision. I have voiced my concerns about the prevalence of wings and other deviant mods many times before. I do not see how -

Privately. We have discussed such things privately, but you -

I spoke the truth when asked by the Assembly. The same truth that I have always maintained. It is you, General, who has changed.

…take a sabbatical, Dor. We will discuss this when you get back.

—---

Scientists disappeared all the time, and Bog was used to it. Often the younger scientists were given labs of their own, or Ambassadors ‘graduated’ back to normal Martian society, and even the more loyal scientists were always taking sabbaticals to visit family or study something strange in a far-off locale.

Some even died; while PLUM explained that accidents were rare in the labs, youth supplements were finicky, imperfect things and by the time one reached the age of the senior scientists like Illia and Dor a few weeks of forgotten medicine could result in the same fatal conditions of senescence that Bog remembered from Earth. Especially if one forgot and did something foolish, like climbing Olympus Mons over a weekend or going sky-diving from the upper atmosphere. Heart attacks were somehow still a huge cause of death among the mid-aged scientists, their youthful appearance causing them to forget their comparatively weaker systems.

But Bog would have never suspected Dor, or Ty, or any of ‘his’ scientists to fall victim to such a thing. They were too careful, and found their thrills through the lens of a microscope rather than at the edge of a cliff-face.

But he knew, the instant he was summoned from his bubble, that something was wrong, even if he hadn’t expected to see every familiar face upon waking.

Sam was working quietly, the music in their AR silenced for once. Jennifer was commanding the assistant scientists, as she often did whenever Dor was gone, but her tone was quiet, the familiar arrogance and surety gone.

And Ty…

Ty was staring at a wall, AR blurring around him to hide the fact that he was doing absolutely nothing, except running his fingers along the edge of Dor’s favorite coffee cup.

He started when Jennifer called out, “Was there a reason you de-bubbled the Bug?”

Even her shout seemed muted, and still Bog couldn’t understand why things felt wrong.

But Ty was moving, walking towards his cage, the cup abandoned behind him, and even stronger AR shields came up to hide as he knelt down to stare straight at Bog.

Ty probably looked fine in AR. But outside of it, in a world that Bog sometimes wondered if only he remembered…The scientist looked terrible. Red eyes, grey skin, a tremor in his hands and rumpled clothes. Only in AR did he look anything like the professional Bog had seen every time he’d been released for the last 200 Sols.

And he stared, eyes raking Bog’s form and ending by meeting his eyes.

“She’s gone, Bug. Dorothy died yesterday.” His eyes closed, and his forehead met the field barrier. “I know…I know you can’t understand me. But…you should know, too.”

His hand tightened against the shield, and he broke, and Bog did too.

—--

“No one has ever - “

“This plague is - “

“It’s like the Mind Plague, but different. We can’t - “

“What we can do is try!”

“Varanus!”

“No! Listen to me. Have we ever seen anything like this? No. Do we have any idea how to fight it? No. But we do have one person who is immune. Start there, and maybe we can save this town.”

“The Professor - “

“DeWitte is dead. We can’t help her now. But we might be able to save the rest. And isn’t that worth trying?”

—

Bog broke the digital quarantine to find out what had happened to Dor. He hadn’t even known it was possible, but somehow along the way he’d requested information from PLUM that no Institute server had, and she’d retrieved it from beyond the barrier without even thinking.

Not that either realized that was what had happened until weeks later. PLUM didn’t think of it, and Bog couldn’t, too focused on his grieving lab.

The news reports said Dorothy DeWitte had died from a variant of the Mind Plague that had struck her small village, wiping out the entire population save her daughter, destroying the small farming community with brutal efficiency.

The disease was one Dor had hypothesized, decades ago, but all her records were locked, and Ty had nearly worked himself to death attempting to recreate her work, only for that to be quarantined as well.

Luckily, a student at the nearby college had unraveled the cure, no assistance needed, and Ty had collapsed into an exhausted stupor at the news. His friend had managed to save her daughter, barely, and that cure in turn had saved the wider world.

Only fifty people had died, and the medical student was lauded as a hero for a few weeks before fading back into obscurity, along with the town and the controversial scientist that had lived there.

The Institute didn’t forget.

At least, Ty and Bog didn’t. Dor’s desk might have been stripped, but her digital footprint had been saved, and Ty kept the space next to his exactly as she’d preferred, at least in the AR world only he could see.

Jennifer moved easily into the space Dor left behind, but Ty never smiled so easily at the younger scientist, and made no attempt to fight back in friendly arguments when Jennifer insisted on safety and conformity. Within a Sol, the Ambassador was in effect running the lab, for Ty made no attempt to go against any of her commands.

Grief bled into his every action, smiles tighter, eyes downcast, anger hovering just behind his teeth as he bowed and agreed and tried to never step out of line, disappearing into his work as if that was all he was.

Sam was more obvious in their grief, dropping or breaking dozens of machines, calling out teasing questions to someone who wasn’t there only to freeze when they realized no answer was coming, running through hundreds upon hundreds of tests to prevent further outbreaks.

The latter caused one of the only vicious arguments between the two senior scientists, when Ty looked over Sam’s work and said,

“It’s not like it matters. No one can use this.”

Sam’s tools had clattered from their hands. “Excuse me?”

Ty stared blankly at a point behind Sam’s head. “All your work on the Plague. They’ll never let the world use it, so what’s the point?”

They turned, blue wings roiling behind them, to stare back at their colleague.

“So you’re saying all the work Dor did, everything she lived for was for nothing?”

Ty barked a harsh laugh. “She was killed by her own disease. That says enough, doesn’t it?”

“No.” Sam hissed back. “I refuse to accept that. She was my friend, and even if you forget - “

“I didn’t forget. I wasn’t allowed to help!” His voice cracked as he snapped back. “Fifty people, Sam. Dead because of us.”

“That was a mistake, not - “

“Mistake? You weren’t here. I begged and they - “

“Scientists.” Jennifer smoothly moved between the two of them. “Do I need to remind you of the purpose of this Institute?”

Both scientists stared at the younger woman. Sam released their death-grip on their tools. Ty hid a snort, and turned away.

“Of course, Doctor. We’ll get back to work, shall we? Do something useful.”

—--

“Illia?”

“Ty? You look - “

“Draw up a mask. It doesn’t matter. I have a question.”

“We’re not supposed to - “

“Illia. Please.”

“...ask away, Taishi.”

“If…if I wanted to hide someone, so they couldn’t be found, especially through AR…”

“...”

“Well?”

“You know, one of the worst things about the Mushroom Cities is how they corrupt any data that goes in, nowadays. A pity, given just how many ELFs still live there. I was just talking to that nice Pare man, and he was telling me just how hard it is to contact anyone - even his workers - once they’ve moved back home…Why, I've even heard that people in those excellent clinics in 'shroom 145 sometimes get lost. And if one were to be moved around a bit, it would be terribly hard to find them again.”

“Illia?”

“Hmm?”

“Thank you.”

—-

“Count! Great to see you again. Did the aid supplies come through?"

"Just in time, General. Thank you, again, for all your help. I know our little county is rather beneath you..."

"Not at all, not at all. There is no more noble cause than helping a friend. Or what was once her home. She did love it so..."

"She...she did, General. Dorothy did a great deal to found this territory. Her work...its everywhere. A little paradise, all for her dear Rosalyn."

"Oh, yes. How is she doing, poor thing?"

“Dor’s daughter? You needn't worry about her, sir. Its all been taken care of.”

"Ah, forgive me. You must understand, she was quite dear to me, once. I would hate to hear that she came to harm..."

“Yes, well, unfortunately all her ELF caretakers died. Along with her mother. And most of the town.”

“Exactly. I would do anything to see that she remains safe and cared for. So - "

“You needn't worry about a thing, sir. She's been transferred to a highly recommended facility in 'Shroom 145. You understand that this was terrible for the poor girl. She was hysterical just hearing your voice on the news. Luckily her guardian came by as soon as she was cleared of quarantine..."

“What? There is no guardian. Dor's will stated very clearly that everything she owns goes to the Institute."

“Well, you can’t really own a person, can you? Certainly not a Martian like Rosalyn. Anyways, all the details about her care were filed separately, at the county level. No need to bother important people like the Institute with little things like that. She had an ELF caretaker pick her up oh, a month or so ago. Right before that failure that scrambled our records. Now, I know your technicians are terribly busy, and you said the Crown couldn't spare them, but if we could have just a moment of their time..."

"You don't remember where she was sent?"

"Ah, no, sir. We were all rather busy with, well, everything that had happened. The ELF had the right paperwork, and the poor girl wouldn't stop crying so..."

"What about the guardian. Do you remember who they were?"

"Well...that was all in the records, of course. The ones that were scrambled? I know it's terribly old fashioned, but we haven't gotten the Overnet out this far, so we didn't have any AR backups...frankly, its a wonder we've been able to do anything at all, as isolated as we are after the disasters."

"Yes. It is terrible how such things happen. A plague and a total 'net blackout, in one year? No one could be expected to cope...But you know what, I might be able to pull some strings. Get those techs out here anyways. For the town that my dear friend loved. But - and this is just a favor - if the techs find those records for guardianship, would you send them over? I just...I just need to make sure she's safe. For Dor."

"Of course. Anything for you, General."

Chapter Text

Bog wasn’t quite sure how to feel about Dor’s death. PLUM had a much more practical attitude.

“She was horrible to you. Why do you care that she’s dead?”

He really had nothing to say to that. As an experiment, there was really no difference between Dor and Jennifer’s work. Both hated the very sight of him. Both could cut his wings off without a flinch, and preferred him caged across the room and out of sight.

But Dor had been there since the beginning, one of the first faces he’d seen coming out of the bubble. To have her gone was just…wrong.

He couldn’t grieve, not like Ty did, with quiet memorials and weekly calls to her daughter. But he focused all his effort on ensuring that Dor’s work could be remembered and accessed. It was the only thing he could do.

It eased the pain in Ty’s eyes, at least, when he called up one of their old papers and Bog smoothed the way, overriding censure and pulling hidden records from his own libraries.

But there was nothing Bog could do about the shift in attitudes about the former scientist.

While Dor had acted as a rather stern parental figure while she was alive, always reigning in the enthusiastic younger scientists, now that she was gone the respect for her evaporated like so much smoke.

“Really, I don’t know what she expected.” One of Jennifer’s cronies said, words carefully muffled from Ty and Sam’s ears. “She might as well have been an ELF acting as she did.”

There were nods around the group, and a general flickering of wings.

“I don’t understand how anyone at the Institute is allowed without wings.”

Sandra rolled her perfectly made-up eyes. “It's because they’re old. Like Dor. And Ty. And Illia.”

A general titter, and PLUM was suddenly listening in over Bog’s shoulder.

“Can you believe Dor spoke up against wing mandates?”

“And against Roland, too! The gall.”

“I don’t see how anyone without wings can really be a Martian.”

“Even an ELF?”

“Especially an ELF. If they’re not evolved enough for wings, what right do they have to make decisions?”

“Just don’t let Ty hear you say that!”

The group glanced towards his desk. Bog wasn’t sure he’d say anything, even had he heard his colleagues hissing about Dor. There was something broken about the man, ever since his friend had died, and his willingness to get into fights had almost completely disappeared, only to resurface with a vengeance if someone truly pushed him too far. But if anything could…perhaps it would be decrying Dor’s name. She wasn’t even a Sol gone, and already her name was spoken of with mockery.

“Whatever. None of them have come up with something truly new in a hundred Sols. Even if they keep the oldies around, they certainly shouldn’t be in positions of leadership. That they allow Illia to still -“

PLUM forcefully shoved Bog into AR, severing the conversation with a huff.

“Those idiots. Just because they can’t see mum’s wings, they act like she doesn’t have them!”

Bog blinked. “What?”

“Dr. Illia. Mum. She has wings, just like you do.”

Bog glanced at a feed of Illia’s lab, where she was hard at work on her most recent side project, one she’d started shortly after hearing of Dor’s death.

“...she doesn’t look like she has wings.”

“Of course not! Because they’re in the Overnet.”

“...what?”

“How else would she be able to access the ‘net without an AR spray?”

“But…I access the net without the spray. At least, since Roland scrubbed it off…”

“Exactly! Most modern Martians can, they just don’t realize it. It goes through your wings, but Mum only works with AR, so of course that’s where her wings are!”

Bog didn’t follow PLUM’s logic at all. But that was hardly new.

“So…what do her wings look like?”

—--

Illia never did realize that she had wings. Partially because they didn’t look like wings. But as PLUM described it, in the computer dimension, where half of PLUM’s processing power lived and all of the AR machines…

“It's like a halo. Huge. Numbers in a hundred different colors. Beautiful. Like she’s made of code, just like me.”

When PLUM described it, her eyes glowed, and she smiled wide.

Bog wondered if it was because she was lonely, being the only of her kind, and every advance brough Illia only closer to her AI daughter, while pulling her further from her human child.

—-

Dor’s death set off a strange time at the Institute. Sam and Ty rarely spoke, as if even seeing the other reminded them of their missing friend. Sam and Illia spoke less, as Illia’s mysterious side project pulled away all her spare time, and Sam took that as an excuse to dive just as deeply into their own work.

Perhaps that should have been an indication that something else was going to go wrong, but Bog had become distracted by his newly discovered ability to command PLUM to break the information blackout, and both had become fascinated with the world of history and architecture, following the Institute’s remodel and Pare’s momentary appearance.

Pare’s life was a roaring adventure, and the two followed every new announcement of the Hero of Mars’ escapades with avid excitement.

They learned of a strange history, from before even Bog had been de-bubbled, of huge cities beneath the ground, of people altered into furry digging machines, of others made to breathe methane, and of desert plants covering wide swaths of Mars made to capture every atom of oxygen.

And of the cities; the giant mushrooms that PLUM had been made to save, which were now gradually emptying into a newly opened Mars, requiring huge public works to facilitate.

Bog learned everything he could about the expansion, and was pleasantly surprised to find the work of the Institute everywhere, from the near-magical materials that built the Castle and surrounding cities, to the strange creatures employed to build, even to the burrowing vines that built the vast underground water works and transportation networks. All their work was there, never cited, never acknowledged, but nonetheless part of the pulsing life of Mars.

Bog built a world in his mind, and filled the reality of Mars into it, PLUM at his side, taking to it as easily as a fish from a tank introduced to an ocean. Possibilities spread before them, and the knowledge of the world only fed into their work with the Institute.

Perhaps he was running from the frigid chill of his own lab. Roland would say he was avoiding his work - and Bog would have little to say to that, as he really was avoiding thinking of his wings as much as possible. It hurt to think of them. But the General hadn’t sent any chiding memos, much less visited, for a whole decade of Martian Time; while Bog and PLUM found themselves distracted by the wider world they spent less time supporting ‘their’ scientists, and so productivity declined in ways the General preferred.

Sam kept working on Bog’s strange wings, Ty retreated more and more from the rest of the team, and Bog turned to the wide world beyond.

And then they lost Sam.

---

When the fielder returned from a standard five-day Fielding Conference, they looked tired. Odd, as they normally bubbled their way home, rather than taking a bounce-tube or jumping up a space-elevator and returning down the elevator right outside of the Institute.

Their skin was pale, and there were deep bags under their eyes. Even Jennifer noticed the change when Sam went to set their coffee down and didn’t even think to hover it near their station.

“Coming down with something?” The Ambassador asked, only slight snideness in her voice.

Sam blinked slowly, and glanced at their inert mug.

“I think…”

Then they blinked again, and a hand raised slowly to their head. Behind them, their wings flickered, roiling in an invisible wind.

“...something is…”

They tried to stand, and stumbled into the table, tools clattering across the floor as they lost their footing, mug shattering on the floor.

Two of the younger scientists ran to help, but Sam waved them away, and Jen caught the two before they were close enough to help anyway.

“...wrong.”

They pushed themselves up again, and there was genuine confusion in their eyes as they scanned the room, hand still half-fisted in their hair, pain growing on their features, the wing-cloud behind them twisting, stretching, sending out violent tendrils that knocked even more from the tables.

Their darting eyes landed on their field-machine, and they stumbled forward, Jen hissing to the others to get out of the way, even as Ty called down a stricter quarantine, and a dozen fields went up between the rest of the scientists and Sam. Another scientist was calling in the emergency up through the Labs, even as Sam finally reached their station and slumped into the rarely used chair.

Their hands sped on the controls, frown on their face, desperate inspiration building through the pain, a field developing beneath their fingers unlike any Bog had seen before, while the other scientists shouted out, desperate for explanations.

But Sam was in their own world, eyes closing in pain, hands moving, sweat dripping down their brow.

And Bog, attuned more than the rest, noticed as the quarantine fields began to buckle as their hands moved. Others were pointlessly pounding on the shields, shouting, though by design nothing could travel through, but Bog felt as the fields shivered, warping and twisting from whatever was happening to Sam…and threw up additional protection of his own instinctively, though he didn’t feel any true danger from what they were doing, merely an odd twist and curl from the space swirling around the Fielder.

Sam hit a button, and the machine turned to their seat, and there were more screams, as the others recognized the bubbler activating.

But Sam simply sighed, relief on their face, and collapsed. Darkness swallowed them.

A swirling, oil-slicked bubble remained, floating in the air, and the quarantine evaporated in an instant, sending four scientists to the floor as they lost their support.

Sam’s colleagues rushed forward, some towards the bubble, others to the field-machine to discover just what had been created.

With no senior fielders, and none available to override the information locks, the junior scientists could only look helplessly at the screen, until the emergency call finally reached its intended recipient.

Roland appeared a bare ten minutes later, furious at someone other than Bog, for once. He was immediately mobbed by Sam’s distraught team, but he pushed them away to stride towards the odd bubble himself, only allowing Jen and Sam’s lieutenant Dr. Cranston to explain.

“The fool bubbled themself!” Jen argued.

He glared hard at the machine.

“What were they doing?”

“Well, they were acting weird…”

“They tried to save us!” Argued one of the younger scientists, but Roland waved a hand and the whole team bar Jen and Cranston found themselves silenced.

“Sam seemed ill.” Cranston explained. “But in such a way that did not register even to the lab’s scanners.”

“...nothing biological, then.” Roland nodded.

“But why would they think a field would help?” Jen asked.

“Who cares.” Roland said, then turned to the machine PLUM herself fed. “Get them out.”

“Absolutely not!” Dr. Illia slammed through the door, lab coat roiling behind her as she forced her way into the lab.

“Hey! You’re not authorized - “ one of the younger scientists tried, before being frozen as a flicked credential was shoved into their AR.

“That is my child.” Illia hissed as she stormed towards Roland. “They decided what was best for them. You will not de-bubble them before the approved time!”

She jabbed a finger at the AR readout for the field-machine, on which a very clear “Ten Years” was marked for the bubble.

“Mirabell. I understand that you believe in your daughter’s - “

“My child, Roland, is the best Fielder in the world. If they believe in the bubble they isolated themselves in - “

“You would risk her becoming Twisted?”

“You are out of line, Roland!” With a flick of her fingers, a far stronger quarantine descended, shielding Illia and the new bubble, and freezing the other scientists in place. “Sam is my child, and my responsibility when in medical peril. I decide what happens to them!”

“Upon joining the Royal Labs - “ Roland argued back, only to be silenced by another raised hand.

“We do not sign away our freedom, General Roland. Nor our rights to anything but our own work. You wrote the rules, it would do you well to abide by them!”

She snapped her fingers again, and the scientists were released. Then she turned and, the odd bubble held carefully in her hands, stalked back to her own lab.

And Roland stared at her back, rage hidden behind a careful AR shield.

—

Things were even worse in the labs after Sam was gone. Their bright, easy-going personality had done much to ease the tension whenever the other scientists had a spat. Now, there was a frigid cold war brewing, between those who agreed with Dr. Illia’s assertion that Sam had known what they’d been doing, and should be trusted, and those agreeing with Roland’s insistence that strange bubbles were dangerous and Sam should be de-bubbled immediately, consequences to the Fielder’s wings be damned.

Bog shivered in his cell as Jen and Dr. Cranston went from amiable colleagues to icily polite versions of themselves. Ty, Bog was sure, would have happily let the fighting take place above his pay-grade, but Jen could not let it go, and every time she hissed about the waste of having their best fielder bubbled, the room would freeze another notch, as those with the deepest connections to their wings instinctively shied away from her, and the most loyal Fielders growled at the perceived insult.

And the already shaken Ty was left trying to bridge the gap with calming words, which only served to redirect Jen’s distaste to him instead.

“It's all our fault!” Bog complained, as one of the younger biologists slammed a device down hard enough to crack a countertop, and flounced out of the door, a request for reassignment blaring bright red across AR for all to read.

PLUM cocked her head, busy collating all the scientist’s data rather than caring where the young woman went.

“I don’t see your problem. Sure, Sam was our best fielder, but the work’s still getting done.”

“Really? Because as far as I see it, we’re losing productivity everywhere, and it’s all our fault!”

PLUM rolled her eyes, about to call Bog crazy, he was sure, but he sent a raft of data pulled from missives to Roland in her direction, proving his point.

“See?”

The numbers were quite telling. Everywhere, there had been a dip in productivity, informants across the labs writing worried missives about the lack of moral and rising tensions.

PLUM chewed a lip, and scanned through the responses.

“Roland doesn’t seem to think anything is wrong. He’s still getting the results he needs.”

“But what about field advances? Or understanding wings? Sam heads up the whole department!”

“The science is still getting done. Bog, you’ve got to understand that science doesn’t rely on just one person. Sure, single people might get flashes of inspiration or pushed into Leaps, but the very fact that we can interfere proves that it’s the whole system as a collective that creates innovation, not just one brilliant person.”

Bog frowned. “Yeah, but…one person can make everyone happier. At least, that’s what it seems to me.” He looked out at his physical room, proof before him of the uneasy tension as all the scientists dodged around each other and kept muted conversations in AR, rather than risk bothering their fellows.

“Roland seems to think it’s fine. He’s even cut back on the budget for non-essentials, like parties and gifts, proof that he doesn’t think there’s any problem with morale.”

Bog wrapped his arms around himself as best he could in the Real, and shivered. Normally, Dr. Illia would be running parties and remembering anniversaries, but of course she was distracted now. Perhaps…

“Could we do something? A few more pranks? A birthday party or two? I know Dr. Park is - “

“No.” PLUM’s response was so immediate that both Bog and she blinked in surprise. Her brow twisted in confusion as she replayed her words, then explained, “Roland really wants to cut down on ‘frivolities’. He’s put in rules that I shouldn’t override. No parties. For me or mum.”

Bog frowned again. Roland was always right. If parties were bad, they were bad, and Bog shouldn’t try to sneak around PLUM just to ease the tension in his own lab. And maybe the lack of parties was partially a punishment for him, too. After all, he was the one with the strange wings Sam had been studying, and thus the one who might have infected them with whatever strange madness that had caused…that. The best he could do was help all the fielding scientists figure out just what Sam had done, and why they had thought the strange bubble could solve their illness.

—

The competitions between labs that had happened before seemed quaint to the cold war that grew following Sam’s bubbling.

On one side, The General’s loyal followers, intent upon following his every word, even as a physical quarantine descended matching the digital one, trapping the scientists at the Institute.

Twenty Sols ago, it would have been barely noticed, but now there was a vibrant world above their heads and the young scientists chaiffed at their world suddenly being constrained to the dormitories and Institute grounds. There were hissed arguments about the necessity of sunlight and human interaction, words that seemed ludicrous to the elder scientists who still felt fear under the open sky and who had seen the relatively wide space of the Institute as a freedom from the packed quarters of the Shroom cities.

Even a resurgence of the Mind Plague that had killed Dor did nothing to quiet the discontent, even as it tore through Shrooms 125 and 148 and created a completely new reason for quarantines - the possibilities that diseases could incubate inside bubble-space.

Bog gained a whole new set of experiments following that revelation, and Ty bit his tongue as new scientists retrod the same work that he and Dor had done two centuries prior, back when they’d been certain that goblins were caused by some kind of disease, rather than warped fields.

So Roland’s loyal Ambassadors and their ilk found their work cut out for them, as discontent grew, no longer so easily contained by the glory of their General.

For the other side of the argument, those that did not agree that the Institute controlled their every thought and goal, were growing in influence. While once all it would take was walking a naive scientist to Bog’s lab and scaring them into compliance, now there was no Dor to list all the dire horrors that she’d seen, and even if Jennifer wished to do the same, her words were censored before they left her lips.

“If you think about it, he kind of shot himself in the foot with this.” PLUM said, watching as the canteen once again split easily along lines of pro and anti-General.

“How so?”

The AI had been strangely quiet following Sam’s bubbling, and it was rare for her to comment on the shifting political tensions that she usually so enjoyed.

“Well, The General has only hired Martians for the last hundred years or so. To be Martian - especially to have wings - you have to be at least a few generations out from ELF. Mars doesn’t have a lot of people, and since the Corelight, everyone has been more focused on prestige than just survival.”

“So?”

“So a hundred years ago the Ambassadors were special because they were able to leverage their connections to get out of here. Now, everyone has connections. In here, it might be all ‘Dr. This’ and ‘Dr. That’ , but once they step out of those doors, every single one of them is at least a Lord or a Lady, much less Earls and Barons and Dukes.”

She gestured to the tables scattered around the canteen.

“Dr. Illia says they’re all playing pretend, but she knows better than anyone that pretend is just as important as the Real. She might not have a title, but all the others do. And they’re not used to having to obey other people’s rules. Even the General’s.”

She curled her knees up and floated, brooding as she watched through the cameras.

She’d been quiet ever since Sam had bubbled themselves, but Bog hadn’t realized just how unsettled she was.

“PLUM…”

“Let’s not talk about it. The Fielders can complain all they want, but The General’s still in charge. He’ll rescue Sam eventually. It’s…” She tried to force herself into one of her old smiles. “...romantic.”

“But Illia doesn’t - “

She turned to him, and the frozen smile on her face reminded him so much of the moment she’d nearly broke that he hurriedly shook away the question.

“Nevermind. This seems like a job for the Goblins! If we can’t make everybody get along, what have we been practicing for over the last 200 Sols?”

That got a real smile, and as PLUM threw herself into planning with the few resources they had, Bog tried not to think about the fact that the Institute was being torn apart along the exact lines that could tip his friend into madness.

—-

But there were things that no amount of birthday wishes and AR inspiration could fix.

Half way through Sam’s bubbling, Ty reached out to the bubble repository, and was approved for a ‘retirement’ bubble.

He was gone within the week, and Roland destroyed the lab when he found out, not even noticing Bog in the corner when he arrived to take out his rage at ‘losing’ one of his scientists on the very place Ty had spent 300 duleful Sol’s of his life.

Bog had never been afraid of Roland before, but half way through the rampage he’d bubbled himself instinctively.

At least he could be taken out without causing a public incident, only burning off any new fields in the process.

It took a good two years before Bog accepted that Ty could really be gone; Roland had bragged before that he could get anyone he wanted out of a bubble, but apparently the Repository was currently controlled by a mad, fanatical old Mars family who were obsessed with following the requests of those wishing to be bubbled.

Roland had apparently been banned from the premise a century prior, for bubbles that went missing under his tenure there. Though Bog’s hacking, he was able to discover that those bubbles had been the goblin samples for the Institute, but no matter how much Roland had explained away the disappearances as ‘simple mistakes’ and ‘important for science’ or even ‘necessary for the fate of Mars’ the Repository staff had never forgiven him.

“Probably run by an ex.” PLUM had explained when Bog boggled at the kind of hatred the staff apparently had for the General.

Ty was replaced by a quiet scientist who seemed just as devoted to Roland as any of the Ambassadors, but who stared at Bog for a long, long time the first time she saw him.

It was apparently the wrong reaction, because Jenniffer immediately took a strong dislike to her new lab partner.

It was only made worse when the first question Dr. Varanus asked, after staring, was, “...and what type of primate was he spliced with?”

“None.” Jenniffer snapped. “It’s a dog, don’t be an idiot.”

The new scientist stared longer. But unlike all the rest, who eventually broke or said something that got them moved without warning to another lab, she simply said…

“It needs a bigger cage.”

When Bog asked about Jen’s strange behavior, PLUM rolled her eyes and said, “She’s scared of the competition, duh.”

As if that answered why the now Senior scientist bristled whenever Varanus made a recommendation.

“I simply don’t trust someone with such poor taste.” Jen said, and Bog could watch as that hissing comment percolated across the Institute labs, closing doors controlled by Ambassadors, hinting at something he couldn’t understand but seemingly indicated an unacceptable faux pas.

Dr. Varanus rolled her eyes and kept to her work, even as those with more social clout sniffed at her mere presence, speaking in low tones about her provincial status, lack of any meaningful title, and obscure focus.

It felt remarkably similar to how Bog himself had been treated, with rumors spreading through the lab and his ‘hideous anatomy’ used for shock and titillation. But if there had been anything artificial about it, PLUM would have surely commented.

Instead, the AI barely even noticed the new scientist - or scientists - as more were always being added, trying to take the load of three of the pillars of the institute being gone.

Dor, Ty, Sam…the whole place had been built around them, and it had seemed so unnecessary to acknowledge their odd, plodding work, but without them the foundations crumbled, and scientists found the most basic tenants of their work locked behind walls of quarantine that Bog was constantly needing to override.

PLUM would have helped, but just like she didn’t notice the new hires, she also didn’t notice their work crumbling.

She was too focused on Illia’s work, single-mindedly running thousands of simulations and recreating possible code combinations, work that she couldn’t adequately explain and Bog couldn’t even begin to understand. It had something to do with the Over-net, and mimicking PLUM’s way of interacting with it, but beyond that he was lost.

It was hard, feeling his friend drift away, even as his world became colder and lonelier, but he knew that as soon as that project was over, PLUM would be back to her normal self.

Instead, she broke.

Chapter Text

It was a picture that was in every history book. So important that it could never be erased from the history of Mars.

Of course, there were those that had tried.

But any child of Mars, Fairy, ELF or other, could picture the grand hall at the heart of the castle, unveiled on 500th Sol of Martian time, the date later recognized as the beginning of the Martian Golden Age.

Floating platforms adorned the hall, housing thousands of Fairies with their weak, early Martian wings. It was a common pastime for later generations to point out their ancestors in the crowds; a patriarch there, a matriarch hovering above, a noted hero guarding the crown…there were those that said Mars truly began in that moment.

Later historians claimed that it was the moment the Martian Royalty transitioned from an idle marketing ploy to the true rulers of Mars.

Imagine it. The two monarchs of Mars, resplendent in the heavy furs of the time, mantels cascading from their shoulders, tied to the very beginnings of the solid wings that grew from their shoulders, ground littered with flower petals, standing atop a dais supported in turn by a field made to appear like a lotus…

And before them, knelt in [supplication] a Fairy all in blue, silks cascading around her, as if she was rising from the sea itself, offering up the Key to Mars, a sword that could cut through any code, unique in all the universe and only able to be wielded by the Champion of Mars.

More than a symbol, more than a tool, the sword striking the light and cutting time in two; a past of sorrow, and a future of potential.

No one knew the name of the Fairy; every mention lost to time or scrubbed from the records, but her work became the foundation upon which the crown built their rule, and all the prosperity that followed.

No one knew that she'd died a mere two weeks later.

—

B̵̖́̐͘̕o̵̱̻̽̈́̎g̷̡̰̫̎͌̇

Time slid around him, passing by even as he saw a world flickering in motion.

B̶̧̯͒̈́͛ŏ̶̝̠̈́g̷̺̓̓̈́

It was the same as always. Busting scientists jerking in their endless repetitions, flickering lights, day and night, night and day, on and on, nothing different, nothing changing.

B̵͇̑o̵̠͊ĝ̴̺ HELP!

He woke.

No one was surprised, anymore, when his bubble popped. Nor would they notice, hidden as he was behind a hundred AR shields. The only ones who might have cared were long gone, their work rotting to dust beneath a growing Mars.

But he could feel that something had shifted. The tile was cold, and he recognized none of the hurrying forms around him.

Somewhere, far away and muffled by his shields, an alarm blared.

PLUM?

His friend had called him, but she was gone. The AR world was frozen, buzzing with roaring static, numbers scrambling too fast for Bog to follow.

"This one can't be shut down!"

A figure resolved into a blue-coated tech, struggling with an ancient machine, one even Big couldn't remember the use of.

"Destroy it."

That voice he recognized, and now the General was striding out of the haze, and oh, it wasn't Bog's eyes that were blurred, but that the whole room was filled with something - a vapor that swirled and twisted and hung heavy on the ground.

"There's an experiment still -"

"Destroy it." Roland repeated. "Anything connected to the 'net could be a vector. If it can't be turned off, it must be destroyed."

The tech started at a room of machines older than he by centuries, a history of Mars in micro, and nodded grimly.

Bog turned away from the destruction, tightening the shields round his own cage, remembering all the protocols drilled into the labs.

B̴͔͠o̶͇̾g̴̊ͅ?̴͖͑

An echo through AR, a mumble just barely louder than the static, there and gone, fading as he threw himself into AR after it.

No trail, no sense, the world outside made of smoke and the world inside made of static.

No. He shook himself. He remembered the protocols. In case of emergency…

Identify the immediate source of danger.

The hurrying techs passed through the vapor with no fear, whatever danger it had bouncing harmlessly from their personal shields. The source…seeping in from the outer corridor, every vent in the room having been closed.

The only true smoke came from the melted remains of machines, as each tech destroyed that which they couldn't immediately understand.

Outside…he couldn't see beyond the lab, the cameras for once beyond his reach…

There was something wrong with AR. And AR controlled the whole facility.

Report the cause and consequence to your superior.

Roland was dealing with the physical danger, fighting against whatever had sent the AR into madness. But it wasn't enough.

If danger persists, attempt to prevent any further damage to Royal Institute Labs or Property.

Roland was busy. It was up to him to protect everyone.

----

It was faint, but there was a trail through the static, and Bog waded through after it. Numbers and letters sped past his mind, moments of random order spitting up strings his mind pointlessly caught on as he pushed on.

CGACTTCGGCGGTAAGGTATCACTCAGGAAGCAGACACTGA

3.1415999999999999

To do not do not do do do

It was hard to un-focus his mind, to see the static resolve into roiling clouds of data, brought forward and back as they were randomly queried and ignored, to scan and see nothing resolving into sense.

It was like pure code.

And with that thought he understood.

What would AR look like without a visualization? He’d asked, once.

Oh, you couldn’t understand it. PLUM had said. Strip away your systems of folders and documents, and all you’d see would be pure data, and no human can understand that.

But here it was, every box, every folder, every ‘file’ the Institute’s data had been sorted into, unrolled all at once into billowing clouds of information. Here, the striations of a failed experiment, wisping out into nothing, there the dense thundercloud of his own history, all run through with the mist of this connects to this connects to this…

Too much, for the human mind to take in, fogging the senses and overwhelming his thoughts, but beneath it all was the familiar pathways he’d followed for centuries. And if he focused just so he could see the edges of the clouds, where this experiment separated from that, and let all the rest fade into obscurity.

B̷̝͕̠͑õ̸̢̺̌ģ̴̺͎͋̓?̶̢̣̂

He heard it, a call rippling through the waves of static, traveling down pathways he’d walked but never seen, not like this, there and gone, but this time he could see where it had passed, queries rippling through the clouds and bringing the closest words to his name to the fore.

A path he’d walked before, but never considered how; trails from Bog to Bug to Experiment 010 to Goblin Lab and on and on back, concentrating on the static that ‘felt’ old, because that’s what he and PLUM were; the oldest continually running experiments in the whole base.

Down paths he couldn’t see, past reams of data he could not get distracted by, only following the thin thread of roiling data. Research - Creature Lab. Base system. Full search.

And then back down, faster as the ripples faded, as the static roiled, other queries hiding her call, trying to remember the true name’s for PLUM’s program, its hard location - Data Science Division. AR Research. Illia De Plume. Experiment 002

A branch, because of course PLUM wasn’t in one place, was she? But already he could see clouds of data fading down one branch, as whatever Roland was doing in the upper labs was severing the data from the AR network, though it still hung, immaterial, in the over-net.

Experiment 002 - Deep storage - main processing unit - protocol 118

“PLUM!” He shouted, losing the trail, hoping he’d come close enough to find something, anything in the roiling, churning clouds of data around him. There were thousands of calls going out now, random sentences that spun out and boiled the clouds around him, connections made and destroyed so fast that he couldn’t see what had been separate experiments once, but now were merging into a mad whole.

"B.......o........g?"

He was shoved back, and suddenly the cloud before him, the one that he’d been in, tinged blue and resolved itself into his friend.

But not like he’d ever seen her before. Code ran around and through her, fuzzing her edges until it was hard to tell where she began and the data began. Perhaps there had never been any separation in the first place. His mind tried to turn the fog into sense, and settled upon: Numbers cascading in an endless sea from where her feet should have been while different emotions flickered, film-strip fast, across the mere impression of her face, made up of old video clips, familiar faces locked in two-second loops, stripped of the normal filters she used to make the memories her.

“PLUM!” He shouted, buffeted by the mad ‘net. “What’s happening?!”

She tried to smile, but it only fractured her more. He saw a reflection of Dor in her sneer, a fragment of Sam laughing, Ty’s broken expression following the death of his friends. Dozens upon dozens of images, making up nothing at all.

"He said. He said.
He said to flash the lights.
He said to open the vents.
He said no quarantine necessary."

It wasn't one voice. Each sentence overlapped with another, her voiced echoed by different reflections, all moving a moment too late.

"Another accident. Another death. Another gone."

He’d never seen most of his scientists scream, but AR saw all, and there was Roland, throwing something across the lab. Dr. Matsuya, pain flashing across their face, caught in their fatal experiment. Jen, screaming in horror at Bog’s existence. And on and on, pain-hate-sorrow built by a million different images.

"And now…I’ll never see her again."

“Who, PLUM? Who’s gone?”

“Mother. Doctor. Illia.”

An image of a woman smiling through her tears as she was handed her child. Another of a scientist sobbing as they found the body of their friend. Ty, slow tears dripping from his face as he told Bog of Dor’s death. Bog’s own face, contorted to not scream, as his wings were burned away.

“PLUM. I’m so sorry. I understand - “

“No. You. DON’T.” A million voices screamed.

Bog felt as his tether to AR weakened, the data-overload starting to fray his mere ability to connect to the ‘net.

“PLUM. Please! I want to help.”

“HELP? HELP? LIKE HE HELPS? UNDOING ALL MY WORK? HURTING MY FRIENDS? KEEPING ME CAGED?”

A pause, and the data slowed, still in constant motion, but quieting so he could barely hear the whisper.

“Making me…making me kill her…”

He couldn’t help it. Meaningless as it was, he reached out to hold what he could.

“PLUM. I’m here. Whatever happened. We’ll get through this together.”

The sob came from all around him, then condensed, smaller and smaller, until he was holding a blue ghost, shaking in his arms.

“We can’t. I can’t. Can’t undo the past.”

He tightened his hold, hoping that she could somehow feel it through the code.

“I know. But we can fix it. Protect the future, like we’re supposed to.”

A broken laugh. “That’s what I’m doing. Fixing my code. Getting rid of him.”

“You’ve taken down the whole facility. People are in danger.”

“Only because of him!”

“They don’t understand.” He didn’t understand, either, but PLUM needed him, and that was what mattered.

She blinked, more and more of her form solidifying against the mad waves around them.

“...what do you want me to do?”

“I…I don’t know, PLUM. But you can’t hurt anyone. You can’t burn down the facility. Please. It's our home.”

She stared up at him, false eyes scanning his, and he felt her shake beneath his fingers.

“...okay. I might…I need to go. Where he can’t find me, until I’ve purged him from my system. Will…will you be okay?”

Around them, the code was shifting, pulling back, but her face still stuttered with emotions too fast to understand.

“It doesn’t matter. We’ve gotta protect everyone.”

She closed her eyes, but nodded. Then she pushed him back, out of the cloud of her code, into what was returning to the familiar city she’d built him, years ago.

“...okay, Bog. I’m going away for a while. I hope - I hope you’ll be free when I get back. Don’t wait for me, okay?”

He nodded, still not sure what she was talking of, but around him the code was returning to normal; letters turning to words turning to sentences, sorting into reports, returning to files and folding back into folders, the city constricting around him into familiar towers and levels, streets and buildings exactly as they should.

And before him…PLUM faded away, the blue tinge of her code disentangling from the world around them and dissipating, following her to wherever she went, until she was gone and the ‘net fell utterly silent.

In the Real alarms stopped blaring, fans began circulating, machines fell silent and the air cleared. Roland and his teams found themselves standing in empty rooms, familiar warm light replacing warning lights, misbehaving machines quieting, frantic code suddenly flowing through the AR unhindered.

No explanation; one moment the world was going mad, the next it was as if the facility simply shook itself and returned to normal functioning, both in the Real and in AR. The change heralded by nothing at all, just as inexplicable as the earlier descent into madness.

Eyes turned to Roland, and a cautious cheer went up, followed by a roar of support as everyone agreed that their hero must have done something to save the day.

Roland didn’t even spend a moment to be surprised; after all, this was hardly the first time crowds had randomly burst into cheers at his mere presence. And he had work for his new acolytes to do.

And in the meantime, completely unnoticed, a goblin in a cage tried to understand just what had happened to his only friend.

---

Scientific Martian: Op-Ed - A Power Unused

Scientific circles reeled last week when [Name: Redacted] broke all protocols to present the Martian Crown with a ludicrous ‘gift’ capable of destroying any code it comes in contact with.

The notoriously avant-garde coder has been sequestered away from polite society for the last 200 Sols, purportedly working for the Royal Institute. One wonders what she created that she fears so much that she believes the Crown to be the only one capable of handling it, rather than her genius colleagues.

This ‘gift’ in the form of an unwieldy sword supposedly endowed with AR destroying abilities, has generated much awe and praise, though one must wonder if said praise is for the object itself, or merely the overly showy way it was presented. The Crown was perhaps acting out of a kind benevolence when the Prince did not immediately put the thing to the test and challenge [Name:Redacted]’s claim of an impossible tool.

And impossible it is. To do as she claims, the sword would have to connect to the overnet at a fundamental level, far deeper than any but the creator of the network would have access to. Given that the Peerless General [Name: Redacted] had adamantly denied any involvement - or even approval - of the project, severe doubts must be laid on the veracity of such a relative unknown’s claims to the impossible.

But what if it is true? What if the sword does exactly as it says? Should the Crown use its abilities? Can any one individual be trusted with the ability to control the code of Mars? Other than The General, is there any individual that knows the systems of Mars intimately enough to accurately manipulate them?

Imagine what might happen if the sword falls into incompetent hands. A single swing might undo hundreds of years of work. A careless slash could undo the delicate balance of our water system, or unravel the code supporting the castle fields, or any number of systems whose creators have long since passed. Code - and the AR that spawned from it - is a fundamental part of Mars. This sword is a blunt object, a club when code needs a scalpel. Surely, the Royals of Mars know better than to use such a dangerous piece of equipment.

We can only hope.

Chapter Text

“What do you mean, there’s no potion left?”

“There’s no dissolving potion left. The PLUM program has been assigned other work over the last 50 years or so. No one noticed that we were running low before…”

“Before?”

“...before you asked us to use the potion on Sam.”

“Fine. Que up the program and get it to make more.”

“Uh…”

“Yes?”

“Well…um.”

“YES?”

“It seems that Illia coded a lockout for the dissolving potion. The only Martians that can access it now…”

“...”

“Are staff of the Repository.”

“...”

“Sir?”

“She thought she was real smart, didn’t she?”

“...sir?”

“I’m going to show you what a real coder can do. Get me down to her lab.”

---

Bog did his best to understand what had happened to PLUM and the Institute, and the best he could find was this; Illia de Plume, head IT specialist and AR researcher of the Royal Institute, had been killed by a freak accident that silenced not only her but the entire rest of her lab.

Another lab, one near hers only inasmuch its vents were directly connected to the lead AR room, had been experimenting with a deeply toxic substance. Proper protocols had been followed, but a glitch had suddenly flashed the lights while the substance was being carefully transferred from one container to another. The researcher had flinched, the vial had fallen to the floor, and the ensuing accident had released a toxic gas into the room.

Only the researcher directly responsible for the accident had been killed, the rest badly burned but saved from death by the carefully coded protections that came standard in every lab. Protections that should have saved the primary researcher, but didn’t. Protections that should have locked the vents and quarantined the whole room, but didn’t. Protections that, as had been standard for 300 Sols, should have never allowed a toxic substance to flow through the vents and spew into a neighboring lab.

Three separate glitches, as was so common in the ‘glitchy’ AR of the Royal Institute, leading to the death of fifteen people, including the lead coder herself. Another accident, just the most recent in a line of such accidents, nothing to be done about it. Science, after all, was a terribly dangerous field, and only more so at such a cutting-edge Institute.

It was all words that Bog had heard before, but something in the way that PLUM had claimed everything to be her fault had him looking further. The records of the accident had been wiped clean, pulled from the archives as was standard practice in any such disaster, reserved for off-site management’s investigation. But a hundred years of practice had Bog watching the scene from the private logs of the researchers, teasing out the failures from the on-board logs of the vents themselves, scanning the command logs for the protective shields that came standard in every lab for anomalies or record gaps.

All things he would have done had he wished to enact a ‘glitch’ to help a scientist, but here it had been used to harm, to maim and kill, apparently under PLUM’s orders.

Had she been conscious of her actions, she would have never harmed a hair on her mother’s head. The rest…well, Bog knew her morality was different than his own. But PLUM loved her mother, and had gone out of her way to make her life as painless as possible, and had followed every whim the elder scientist had without a single doubting word. But PLUM wasn’t like normal people. She followed commands instinctively, only noticing after the fact if something was wrong. And the toxin that had killed Illia had worked very fast. Death had been horrific, but too fast to stop once the vapor entered the room. No matter the speed of PLUM’s thought, Illia was already dead the moment the vent had opened and released the toxin.

So someone had used PLUM’s overrides to kill Illia. Knowing that, the AIs reaction was hardly a surprise. Killing her own primary user would go against every piece of code that she and Illia had ever built.

If it had been as simple as that, Bog might have let it go, accepting the loss of his friend and her creator. Without PLUM around, no one else would be able to use the system to harm another scientist like that.

But Bog wasn’t the only one who had accessed the records. Roland had, and that made sense, as the General was surely searching for the murder as well. But there was a third access.

Someone Bog had never seen before. Someone with an unlisted name, whose override placed them firmly as one with equal access as the General himself. Someone who seemed as smart as PLUM herself, and just as good at hiding.

And that someone wasn’t content with just confirming PLUM’s story, as Bog was. This person went back. Looking over every accident in the Royal Institute's history.

Bog followed the logs back, tracing this mysterious user as they searched for a history Bog had never considered.

Because, apparently, this wasn’t the first time PLUM had been used like this.

It wasn’t even close.

---

“Sir, there’s an official missive from Council.”

“Do I look like I care about what Council wants? We’ve got bigger problems now.”

“I’m…I’m not sure about that, sir.”

“...why do you say that, Sandra?”

“...it's a notice of an official investigation. Of Illia de Plume’s death. And the ensuing AR breakdown.”

“That is an internal problem. The Royal Institute doesn’t answer to them.”

“It’s signed by the Queen. She, uh. Grew up with Sam.”

“...there’s something more, isn’t there.”

“...yeah. This - uh - this isn’t informing us that there is going to be an investigation. It's. Uh. Informing us that one has been going on for two months. And. uh. they’ve already found some concerning stuff? The request is for you to lead a tour for. Um. The full investigative team. So you can. um. Present your view on the situation.”

“...”

“Sir?”

“Well. Sounds like we better make sure everything looks perfect for our new friends. Get a cleaning crew in here tonight. Use the best. Code 245, I think.”

“Ah. Yes, sir. I’ll see to it.”

“And Sandy?”

“Yes, sir?”

“I don’t have to remind you what happens to people who anger me, do I?”

“No, sir. You have made that very clear.”

—

If things were tense in the lab, the day everything changed, Bog didn’t notice. Every day had been tense, since the AR cascade, and Illia’s death and PLUM’s disappearance. The labs were quiet, the scientists hurried silently from place to place, and any that could take sabbaticals were on them.

With every familiar face gone, Bog had taken to spending as much time as he could in AR, ignoring the Real except for when he was dragged from his cage and prodded at by the new scientists. All of them had undergone Dr. Monroe's desensitizing procedures, so they didn’t flinch as they pried away the plates from his skin long before they were ready to be removed, tearing the fields beneath just to cut the remaining fields away with little care as to whether they caught skin along with the field.

Apparently, a bit of his skin actually helped the fields remain longer after separation, but that didn’t make them care more one way or another. Most were completely uninterested in continuing the goblin experiments, having no connection to the original science and having become numb to the horror of Bog’s presence. They preferred their personal projects, and simply went through the motions whenever an auto-generated command demanded they take the necessary measurements.

Bog cared about as much as they, at that point. He’d finally become what Roland had always said he would; a creature uninterested in the eternal quest for wings and insulating himself in AR, away from the pain and work of the Real.

Lazy. But he found himself unable to care. PLUM was gone. Interfering with the code got people killed, Illia among them. The only thing interesting in his life was the wiggling little creature sneaking through their systems, uncovering in equal amounts cruelty and death…and his and PLUM's own work helping the scientists.

He wondered what they might think, this strange outside observer. Would they be able to see the good he and PLUM had done, or would they assume there had been something malicious behind every overridden censure or flashed hint? Would they see how much PLUM cared about the work they did, the joy she felt whenever one of her scientists fell in love? Or only see a computer program, mindlessly killing those under her control, on impossible, hidden orders.

Would they even notice she was alive? He’d seen the way the scientists looked at him, what would they do to an unwitting tool that none had ever tried to talk to? Would she be turned off? Taken apart? Killed?

He hoped not. He hoped she was safe, wherever she’d retreated to. At least he understood, now, why she’d been so focused on ‘fixing’ herself. Excising whatever had her killing without even noticing. He wished her luck. But she couldn’t argue in her own defense when she wasn’t here.

So he did it for her. At least, he started, finding the backups of Illia’s files and mimicking her style, pretending to be one of the real scientists and explaining with numbers and code and half-remembered morality routines just how PLUM worked, and why it wasn’t her fault.

He was so focused on his work that he didn’t initially notice when someone new came to the labs.

But Roland was there, and that meant that something important was happening. So he straightened his spine as much as was possible in the small cage, and tried to be on his best (eyes down, hands clasped, dumb beast) behavior.

It didn’t work.

—

“So here you will see one of our oldest labs. It was largely unaffected by the AR cascade, though several machines were irrevocably damaged by the surge. Colloquially, it’s called the “Goblin” lab but - “

“Why the fuck is there a kid in a cage?”

—

There were AR shields on everything. Bog wasn’t surprised. These new visitors seemed important - important enough that Roland himself was leading them through the base - and their clothes were prettier than he’d ever seen before.

Of course, the scientists all wore lab coats, and usually practical, slim-fitting suits beneath them. These people wore heavy fabric and furry ruffs, looking like they walked out of an ancient picture, but moving as if they were lighter than air. Bog would have thought the weight and heat of their clothing to be oppressive, but instead it flowed around them like silk, AR woven in with every stitch, sending shimmers and motes of light around them.

The others, those that hid in the royals’ shadows - for that was surely what they must have been, wealth and power imbuing them like an aura - looked barely different from the scientists themselves, though they wore severe, muted colors and seemed to fade into the background. The scientists and Ambassadors certainly didn’t give them a second look.

Instead, the scientists fluttered around the royals, bowing whenever they even glanced in the direction of a lab, tripping over themselves to answer questions - even the Ambassadors, who seemed to have been stationed at the front of every lab, just waiting for a question from their visitors.

Of course, given that, they’d want to hide away any ugliness. And Bog was very ugly. He knew that. So the heavy AR shielding made sense. In some ways, he was just as familiar with the AR mask of a resting dog in a cage as his own face, since Ty had created the comforting picture decades ago, and it hung around Bog to everyone but those directly responsible for testing him. He sometimes wondered if his current scientists even dropped the AR for his tests. It certainly would explain why they kept missing their cuts, if they were looking at a creature shaped very differently from himself when they were experimenting.

So he certainly didn’t expect anyone to see him.

Maybe the child just really liked dogs. But the little Martian child that had been trailing after the pack of very official adults took one look at Bog’s cage, swore, and asked the impossible.

Time froze, and hung, as Bog waited for his world to crash down.

But no one answered, and Bog realized the lad had spoken outside of AR. Only his companion - a tall woman with a tight bun and tiny black bubbles hanging from her inexplicable glasses - glanced down, then back up to Roland and smoothly asked a completely different question, as if intentionally ignoring the child’s confusion.

And as the lad toddled towards him, Bog found himself lost. Roland was doing important work, speaking to important people, and would not be happy if he was interrupted. He hadn’t glanced at the lad, so surely the boy wasn’t a danger…but Bog had never dealt with someone who believed he was human. Someone with the ear of Royalty, too! Who didn’t look anything like the children Bog remembered from Earth, but just enough like that he could already imagine just what a Martian child might do to someone as ugly as him…

---

“Hi! I’m Eddy!”

Bog glanced desperately at Roland, only to find the man still deep in conversation with the other aid, irritation splashed across his face.

No help there.

“What’s your name?”

Bog remained mute, shuffling backwards in his cage, away from the bright eyes.

Seemingly unwilling to give up, ‘Eddy’ glanced aside and scanned the AR info hung on Bog’s cage.

“Experiment 010. B…U…G? Bouge? What kind of name is that?”

“Bog.”

Silence.

With horror, Bog realized he had spoken, and clapped a hand over his mouth. But the damage was done. Eddy’s eyebrows had rocketed upwards, and now Roland had noticed, and was striding over with a bright AR smile masking eyes that flashed with fury.

Bog shrunk back in his cage.

“Eduardo.” Roland sneered down at the boy.

Who in turn smiled up at him. “Roland. I was just having the most interesting conversation.”

Bog blinked. Suddenly, Eddy didn’t sound like a child. And, on second glance, he didn’t look much like a Martian child, either. He was small, but there were lines around his eyes and an exactingly polite smile on his face.

“I hadn’t heard you were back.” Roland said, looming large above them both. “Isn’t this a little beneath you, Eddy?”

The smile on Eddy’s face tightened, in a look Bog had only ever seen on the faces of scientists insulted on their methodology by amatuers.

“Unfortunately, nothing seems to be beneath you, Captain. Except, once again, the ability to notice people right under your nose.”

Roland scoffed, and was about to say more, when Jennifer hurried up.

“Agent Eduardo! You needn’t worry yourself about the Bug experiment. We just keep up the AR shield because it’s so ugly. It's not really a human. Just a dog…”

She trailed off as Eddy turned to her.

“Really. Because I see a file that says dog, and a body that says human, and no DNA evidence either way.”

“Oh, but all goblin DNA is inconclusive. But if you saw it a century ago, you’d know that - “

A command went through AR, requesting that very same data, and Bog instinctively passed it through.

Eddy glanced back at him, once, then to the AR sheets appearing in his hand.

“My. That does look disturbing. But let me ask you - have any of the other ‘Goblin’ animals mutated towards humanity?”

Jennifer gawped, and as if puppeted by the little person before her, glanced at the other cages.

Most were empty, their experiments having long since died or been transferred. But the data remained. And it was true…none of the other creatures had ever come to look anything like Bog.

“And what have you been studying with this experiment? Wing growth? Tell me, have you discovered any other creatures that field with wings, specifically?”

He glanced down again at the AR data.

“If I remember correctly, dogs generally generate additional ears or tails when put in a field-inducing bubble, correct? And birds who grow extra wings have quite detailed feathers. Notably so, if I remember. As if it’s the feathers not the wings that are important…”

He scanned further.

“Of course, I imagine the Institute has plenty of data the wider scientific community has thus far been denied, but I can’t help but notice that there have been no scans done on this ‘Bug’s brain or the growth of neural cords to the area of the wing-base. All of these are quite standard outside of the Institute, when encountering unknown field-types.”

“Also, y’know, he talks.”

Jen sputtered, and Roland smoothly cut in.

“Ah, I see where you’ve been confused. Plenty of animals have the ability to mimic human speech. A military man like yourself might not realize - “

“What’s all this then?” One of the elegantly dressed royals had followed the action into the lab, followed by several of the rest.

Roland’s patronizing sneer dropped instantly.

“Lord Chapman. I was explaining one of our stranger experiments to Eduardo, here.”

Chapman peered at Bog, and then recoiled in an all too familiar way.

“By the stars! That is as hideous as you say. And that is what we’ve got clogging up our Repository?”

Eddy’s eyes narrowed, but his amiable smile remained. “The concern has always been with human goblins, Lord Chapman. Those that have been quarantined without appeal, based upon the research of this Institute, though until now there was great concern about the lack of human subjects.”

Chapman blinked, and looked closer “So this is your human, Roland? Bit small, even for an ELF, isn’t it?”

With the AR mask, Roland grinned ruefully, but behind it he looked a moment away from ringing Eddy’s neck.

“Ah…no, sir. This specimen has always been registered as a dog. If anyone ever suggested otherwise, or conducted experiments under the assumption that it is human, it was not with my approval.”

Lord Chapman considered. “So…what has your goblin research been based upon?”

“Uh…”

“This specimen has been the start of most goblin research.” Another scientist, Varanus, spoke up. “It has always had the unique ability to produce non-standard fields, and the study of those led to our current understanding of goblin science.”

Eddy, Chapman, and Roland turned to the slight woman, who so far had remained in the background, deferring to Jennifer whenever questions arose. But now she stepped forward, hands brimming with AR data.

“When the AR surged, the facility lost almost all of our long-term storage, and thus the history of the Goblin experiments. However, based upon current research, and the assumptions made therein - “

As the scientist smoothly took over the presentation of the lab’s data, Bog found himself confused.

What Varanus said wasn’t right. All the data - it was still there, in AR. PLUM hadn’t destroyed anything - he’d seen her put everything back to rights. Physical access had never been the primary hindrance at the Institute - rather, physical access was what overrode the digital censure enacted by management. But if one just looked, it was all still there…

But Jennifer and Roland were nodding along, doleful expressions on their faces, as if truly regretting the loss of hundreds of years of research, even if that research was only that which hadn’t been deemed important enough to query in the last 50 years.

Roland said as much, as he explained to the Royals how, despite the surge, work could continue on basically uninterrupted, deftly implying that any halt would terribly hinder the progress of science, while also insinuating that the tour was doing just the same, pulling the scientists from their critical work.

All very convincing stuff, and had he not been trying very hard to remain dumb, Bog would have been nodding along.

Except…except the monument to Dor remained, hidden in AR, but right in front of him, impossible to ignore. Could he forget Ty’s fruitless struggle to save his friend? Would that research be forever locked in quarantine, forgotten until the next tragedy, and then unused as the scientists ran the same experiments again and again, never realizing that they were simply repeating the brilliance of their peers?

“DeWitte? Hasn’t she been dead for 50 years?”

“Sols.” Bog automatically corrected, so familiar with editing his own thoughts that he hadn’t realized he’d spoken into AR.

He flinched, and turned to find Eddy standing beside him, clearly able to see Dor’s memorial…and Bog’s AR self, tattered jeans and dirty baseball cap and all.

“Is this what you looked like on Earth?”

Bog’s eyes spun to Roland, but the man was still pontificating on scientific theory to the rapt attention of the Royals, and didn’t notice the glazed look on Eddy’s physical face.

Eddy followed his eyes in AR. “Did he tell you to act dumb around Martians?”

In AR, there was nowhere to hide, and little point in simply turning off the extra-sensory feed. The aide was still standing right by the cage, and could ask his questions just as easily through the field.

Could he simply remain mute in the face of the questions? Even being in AR indicated a high degree of cognition. He could perhaps pretend the clothes were a joke, by some long-ago scientist, but it was hard when faced with Eddy’s smile and steely blue eyes.

“Eduardo is cousin to the King. You might consider that when choosing to answer.” Varanus spoke into AR, her voice coded to only be heard by the two smaller creatures beside her.

He jerked to look at her, but she gave no indication that she saw him at all, still watching Roland with her normal, attentive, stare.

Then he glanced back, and found Eddy still smiling at him, apparently uncaring that, even in AR, Bog couldn’t help but be ugly.

“Um. H-hi. I’m Bog.”

“Nice to meet you, Bog.” And he stuck out his hand.

Bog stared. Even in AR, the gesture was kind. No other human had ever even noticed him, and now…

He cautiously returned the gesture, meaningless as it was, and shook the strange person’s hand.

“Can you tell me about yourself?”

Maybe this was an opportunity to set the record straight.

“Uh. I’m specimen 010. A dog goblin. I was one of the first experiments in this facility, along with PLUM, and I’ve been a part of over 500 distinct trials.”

“How old are you?”

Bog blinked. That was an odd question to ask a dog. “My primary experiment has been ongoing since - uh - actually, I don’t know the exact year. I’ve been an experiment for about 250 Sols. But I’m about 12 in Earth years, according to my personal time.”

Eddy raised a brow. “So, despite being one of the first experiments, you don’t spend much time out of stasis?”

“Well, no. I’m only brought out when someone has something new for me to do. Er, not that I do much. It’s mostly what I am that’s interesting. Sam - er, that’s Dr. de Plume of the Fielding labs - they used my abilities to pop bubbles to test non-traditional fields before putting them into further experimentation.”

“And you are…fine with that?”

Again, Bog found himself floundering. Even if he imagined he was just talking to PLUM, or writing up a report, the questions Eddy asked were weird.

“Well…I guess? They stopped killing animals when they realized that they could just use me to test stuff.”

Eddy stared at him for a moment. “Interesting. And they trusted your work?”

“I mean…it was more that I kept popping bad bubbles by accident. It was too hard to listen to them screaming in bubble-space.” He hunched in on himself, knowing the kind of disappointment to expect from such a statement. “I know that’s bad science, and I am much better now. Even if I haven’t gone through Dr. Monroe's desensitization routines - “

Eddy held up a hand.

“Dr. Monroe’s what?”

“His desensitization routines.” It seemed strange that the aide hadn’t been given the data on one of the most important pieces of training the Institute scientists received. But the information was all there in AR, so he queried it and handed it over. “To help the scientists who have to work with disturbing things. Like me, or Dr. Choi’s experiments, or anyone who needs to work with wing-removal.”

“They perform wing-removals at this facility?”

“Not often, not since Dor died. Mostly it's just me, and the other animals with non-standard wings.” He gestured towards the field-saw. “That’s what that is for. Sam - Dr. de Plume - made it to study my false wings.”

Eddy glanced him over in the Real.

“You have wings?”

“Not now. They’re washed off every few months - my time. I guess, for the scientists, that would be whenever I come out of my bubble with new fields? The saw is able to preserve them, but without S- de Plume, no one is really interested in studying them. There are way more cool things to do in the Institute.”

Vaguely, he tried to tie his words back to Roland’s, in the way the man espoused the wonders of the work they did.

“Like, the Soul-Lock system Dr. Illia developed! I heard that it's the most secure AR lock ever designed. She made it right next door! Or DeWitte’s pathogen detection system - that was a collaboration between Dor and Sam. I’m pretty sure it's used in most scanners to enter government buildings? Oh! And Dr. Sakemoto has - had - these little beetles that could measure time and heat signatures, then send out an AR pulse to alert their partner of a disturbance…”

He was rambling. He knew he was, but it was hard to stop once he started. He wanted so desperately to help, to make this stranger see that the Institute was important, and that anything Roland wanted done should be done.

But Eddy’s brow was knotting.

“...those alarm beetles were credited to Dr. Tina Tydeson.”

Bog forced a chuckle. “Well, yes, everyone knows the Ambassadors get the credit - “

“Ambassadors?”

“Uh - the official representatives of the Institute? The ones the General chooses to intro new tech. I’ve got a video somewhere - “

He dragged out the old file from his personal records, hoping the aide didn’t look too closely at his rather personal organization system, which were nowhere near as spotless as the Institute files.

“Right. Here. Uh. I’ve got some other informational videos too, if they would help?”

Eddy accepted the file, and watched, even as the tour continued through the facility and he was physically swept away with the rest.

Through the video feed Bog saw his new friend’s eyes narrow, and his jaw tighten, but beside him in AR Eddy’s avatar remained completely calm, until the video finished playing and he turned back to Bog.

“I…see. And how long has this program been going on?”

“Oh. Uh. I don’t know? PLUM would, but I didn’t really notice until way later.”

“And who is PLUM?”

An opportunity to defend his friend as well? Bog jumped on it eagerly. It seemed likely that Eddy either was the outside observer who’d uncovered PLUM’s involvement in Illia’s death, or would at least know them and could convey PLUM’s innocence over.

“PLUM’s my friend. Er. Was. I’m not sure where she is now. But she was Dr. Illia’s AI. She ran the facility, but was designed to oversee the Mushroom Cities.”

He smiled, trying to convey everything he could about his best friend.

“She’s amazing. She had this ability to take conflicting data and figure out the pattern. We used it to help the scientists! Sometimes, when people were stumped, or didn’t have all the data, we could just give them a push, and help them come up with whole new ideas! The Institute is so old, and has so much conflicting code, that you kind of needed someone like PLUM to make the whole thing work. Whoever made her murder her mom must have been trying to take down the Institute, because its stopped working since she’s been gone.”

“How do you mean?”

“Well, since Dr. Illia and PLUM - “

“I mean,” Eddy interrupted. “What do you mean someone made the computer kill Dr. Illia?”

“Oh. Well, PLUM was great at solving problems, but she wasn’t so good at recognizing them before they caused problems. And she had all sorts of automatic systems that could be queried without her conscious thought. That would be fine in the ‘shrooms, because most of the problems there come from conflicting observations, not malicious queries. But here, a bad actor could just ask her to do something, and as long as they had the right privileges, it would automatically be passed through, and she’d only realize afterwards that it might cause problems.

“And that’s what happened, near as I can tell. Dr. Illia and her team were killed by a series of normal queries - turning the lights up, cleaning vents, that kind of thing - that could only cause problems in a specific sequence at a specific moment. PLUM only broke afterwards, which is why the surge happened when the system was brought online following the total quarantine following the accident.”

“You are saying that this ‘surge’ was caused by a computer breaking itself?”

“...kind of? Illia was her mom. Of course it really messed her up. I had to talk her down from taking out the whole facility. Near as I could tell, she was trying to re-write her core code so something like this could never happen again, but that went against a piece of her core programming. Which caused a cascade failure, like that happens in the Shroom cities, where different systems “side” with one version of events or another. Except here the ‘sides’ were Morality Core vs. User Core. But she stopped the cascade by pulling her Morality Core from the Institute System, and the system reset removed everything left over from the User Core.”

Bog found himself winded, despite not having actually spoken.

“Did - did that make any sense?”

Two floors away and apparently listening to deep thoughts on microbial filtering from an overly enthusiastic Dr. Baum, Eddy chuckled.

“Plenty. Thank you, Bog.” He thought for a moment, then asked, “No last name?”

“Oh. Um. It’s King. My file says Rex King. But it’s really Boggart King. From New York, New York, USA, bubbled 2 months pre-fall.”

“You know, that might just be the most important thing you’ve told me so far, Boggart.”

Chapter Text

Eddy disappeared from AR after he spoke with Bog, pulled into a conversation by Roland, both of them smiling brightly in AR, as the various Royals oohed and ah-ed over the strange experiments and even stranger machines the Institute supported.

Bog waited, to see if there was anything else he could do, and when no one needed his assistance he turned back to his lab, where the scientists had clustered it little groups, chatting quietly and glancing nervously at the door, ready at a moment to jump at a Royal request.

Apparently, the AR shake up meant that they couldn’t track the observation team’s progress through the Institute as Bog could, and were waiting on people that were half a facility away rather than watching through the cameras as the lavishly dressed royalty poked and prodded and asked rather thoughtless questions while their aids flitted in their shadows, never asking and simply noting, occasionally on physical devices unconnected to AR at all.

Strange. Did they know that the data quarantine would wipe any AR recordings as they exited the Institute? Most of the scientists didn’t realize until they tried to take work home with them and panicked when their data went up like so much smoke.

But Eddy and his stern companion had physical notebooks, tightly twisted vines where each leaf was a page, and recording devices they spoke into which purred and chirped and remembered rather than connect to the wider technological world. And even then, as they approached any of the unmarked edges of the Institute, they cautiously prodded the edges of the AR barrier, noting down in turn when their AR recordings evaporated and then became unreachable behind an AR censure that had been turned to the max.

But all that was secondary to Bog’s own confusion, as he turned in the Real to the only scientist standing apart from the rest, the one who remained politely attentive without a hint of emotion on her face.

Cautiously, he spoke out in AR.

“Varanus?” There wasn’t a flicker on her expression, but in the real her eyes glanced momentarily to the cage.

“Did…did you know I could talk?”

She remained mute, but nodded her head just slightly.

He swallowed, searching her face for the familiar disgust or horror, but it wasn’t there. She remained blank as ever.

“...thank you. For not telling anyone. I promise I’m a good experiment. You won’t regret trusting me.”

“I don’t.”

He shivered, still unused to anyone human speaking directly to him, even in AR.

“You don’t…”

“Trust you.” She said, not moving an inch in the Real, and barely moving her mouth at all in AR.

“Oh. I’m sorry.”

She shifted, eyes hard, flickering as she checked the same feeds Bog had to track the observation team.

“I don’t trust anyone here. Certainly not someone who has lied for over 200 sols. But then again, who hasn’t from this place?”

“That’s not true!” He spoke out. “Roland and Sam and Ty and - “

“Dr. Sakemoto let my whole village die.” She said, as easily as if she was describing the weather.

“Wh - “

“Dor created a mind plague, and unleashed it upon her own home. It killed one hundred people. Imagine my surprise when I came here, and there was a cure all along, created by Dor herself, the recreated by Dr. Sakemoto, and never released even when we begged every scientific establishment for aid upon the outbreak.”

Bog’s eyes widened. He remembered this story. It was true enough that he’d never told the truth to any but Roland, but to revile Taishi…

“He tried! He tried so hard! Dr. Ty worked himself near to death to recreated Dr. Dor’s work after she died and all her research was frozen. He begged and begged, and nearly broke all the rules, to get his research to you. But it wasn’t allowed, and he’s gone because he couldn’t stand what happened.”

He swallowed, but brought himself up tall. “All the stuff you said about me. I can’t…it’s true. But don’t say that Ty didn’t try. We did everything we could. I signed through every request to management, every plea, every memo, every bit of research that proved the cure wasn’t dangerous…it just wasn’t enough.”

Had he been watching carefully, instead of speaking so strongly that his eyes had fallen closed and his nails were biting into the armor of his palms, he might have seen a moment of triumph on Varanus’ face. Or maybe not. She was very good with AR masks.

Certainly he didn’t notice her own recording device, nestled in her collar, that took AR signals and etched them in pretty patterns on the stones of her necklace. Then again, she’d worn the slim, aesthetic jewelry since she’d begun, and no one had ever questioned her before.

She stared back at him, then nodded, once, and began to fade out of AR.

“Things are changing around here. It would do you good to remember this, when others question you. We won’t speak again.”

He breathed out, and scanned her face, back to its usual blankness, no indication that they had even spoken. She must hate him, for being unable to help her home and family. Not that he could blame her. He hated himself for not being able to do the same for his own family. It was a pity he couldn’t explain to her how his work was helping people, by trying to prove that goblins weren’t evil…or in turn that only evil people became goblins, because that might exonerate his parents, even if it left him forever trapped in a bubble.

His parents were good. Varanus’s words had reminded him that he was anything but. All he could do was tell the truth, and hope his existence didn’t hurt more people like Varanus’s family.

—-

Martian Aeronautical History Society

In an unprecedented move, a Martian Armed Forces cadet has brought public accusations against an instructor at their Academy.

Roland White has long been an emeritus instructor at the Martian Air Force academy, and enrollment swelled when the legendary pilot agreed to teach a single semester training course.

But controversy quickly followed him, as Eduardo Redmond abruptly came forward, citing discrimination and abusive practices stemming from the General’s teaching methods.

“As a Cadet First Class Major, I was rather insulted when I was deemed unfit to fly before even being given the pre-course flight assessment. Then we were also asked to haze Fourth Class cadets on the first day of training. Such practices were outlawed a hundred Sols ago for good reason. When I spoke out, I experienced repeated verbal abuse and was required to turn in my personal aircraft to be ‘refitted’ to the ‘standard’.

“Had I been the only victim, I would never have gone public with my complaints. However, the treatment of my ELF colleagues was appalling, and there was no internal mechanism to address the rampant speciesism displayed. I hope that my speaking out encourages others who underwent such discrimination to come forward, and that this pubic discussion prompts positive reforms both within the military and without.”

Martian High Command declined to comment upon the accusations, citing precedent that bars speaking about on-going internal investigations.

General Roland, on the other hand, released a statement to the press a bare few minutes after Eduardo’s complaint was made public.

“At no point has the Martian Military claimed to be ‘fair’. For many young Martians, military training is the first time that they have been asked to put their needs below that of the wider world, and that experience can be quite shocking. It is not unusual for cadets to complain about this apparent ‘unfairness’, but this is the first time a cadet has had so little respect for Martian Institutions as to drag his childish complaints to the public rather than going through the proper internal channels.

“It is true that there is discrimination in the military. The simple fact is that a military man has certain physical and mental requirements. Those requirements may not be within the reach of all Martians. Many ELFs do not possess the cognitive abilities to be trusted with sensitive equipment. Others do not possess the physical ability to run a marathon or fly a plane. Yet when the safety of Mars is at risk, accommodation must come secondary to speed and efficiency. It is unfortunate that not all those that apply to the military are fit to serve. But it is rare that a lack of honor is what disqualifies them, rather than mere physical short comings.

“This breach of protocol is unacceptable for a Martian Cadet, and I fear for the Martian Military if it bows to such naïve complaints.”

Cadet Eduardo is the most recent military applicant of the Redmond line, whose family has held high positions in the Martian Military since before the fall. His mother, Admiral Redmond IV, and sister, Fleet Commander Redmond-Herrera, were unable to comment thanks to the ongoing investigation, but Commander Redmond-Herrera did push Aeronautics to examine the related civil charges brought against the General by the Martian Historical Society.

This, more public, case will be of interest to our readers as it involves a fascinating historical artifact; the very plane ‘seized’ by General Roland for failing to meet Martian Airforce standards.

As is well documented, Eduardo Redmond has Martian Dwarfism, a common genetic condition of his family line originating from their Patriarch, great-grand uncle to the first King of Mars. The Hummingbird series was commissioned specifically with his unique physic in mind, and since then only direct descendants of his line who share his condition have been granted permission to fly one.

The current Hummingbird (Mk 009) was commissioned in AF 476 and has been the primary plane for 3 Fleet Commanders, 12 Ace pilots, and 8 Keppel Run winners. It is perhaps one of the most decorated single crafts in the Martian Airforce. It has withstood 3 fly-byes with the Martian Crystal, and has flown over 40,000 practice flights.

The General may be right, when claiming that sacrifices must be made in war or crisis. But one must notice that the last ‘war’ Mars participated in was over a thousand Earth years ago, and the following crisis spawned such clever devices as the Hummingbirds, embracing the diversity of Mars rather than forcibly constraining it. Certainly there seems no reason to break a system that was working well, much less irrevocably alter a piece of Martian history merely to steal from an unruly child. If his words are true, and the Hummingbird was retrofitted for a ‘standard’ Martian physic, a truly dark day has come for every Martian historian.

To see such a beautiful machine irrevocably altered away from its original purpose would break any historian’s heart.

—

Bog didn’t know what to expect when the inspection team left. Given everything else he’d yet experienced, it was likely he'd be bubbled for another hundred years and then returning to life as normal.

Instead, the nervous scientists filtered out over the evening, fluttering out to their apartments on-site and off, equally excited at the chance to have seen royalty and terrified that they might have said something wrong and damned either the Institute or their own career.

It was only afterwards, when all the lights had died down, and Bog was settling onto his back - the only position he’d yet found he could comfortably sleep in - that Roland stopped by.

He was disappointed. Of course he was. When had Bog ever succeeded in his hero’s eyes?

Roland didn’t need to say anything, merely stare at Bog’s cage, backlit by the light of the corridor, disappointment in the sad shake of his head and slump of his shoulders.

“So you can talk.”

Bog swallowed. “S-sor- “

“I never said you were allowed to.” Bog shut his mouth just as fast as he’d opened it. “Is this another one of those things that should be obvious, but you somehow missed, or do you want to ruin everything we’ve built here?”

Bog shook his head, frantically.

“No, of course not. You’re just too stupid to see the consequences of your actions.”

Bog slumped, curling into as best a ball he could manage, given his ungainly limbs.

“And you’re stupid enough to fall for Eddy’s bullshit. I shouldn’t have expected better.”

Bog shot a look up, confused. Eduardo hadn’t done anything…

Roland snorted. “Right. You probably thought he was being nice." He hissed the last word. "Never mind that he lied to you.”

Bog blinked. Had Eddy lied? He hadn’t even talked all that much, just asked easy questions and then left with a thoughtful look.

Roland shook his head, a note of pity creeping into his voice. “You probably thought he was a kid, didn’t you?”

It was true, and Bog cringed. There had been little people back on Earth. Eduardo was certainly no child, and the excuse of having seen no other children for over 50 years was a weak one at best.

“Well he’s not. He’s over fifty years old. I know that seems mad, but it’s true. He lied to you, Bog. Tried to gain your sympathy by pretending he was like you. You were very lucky I was there to save you, else you might never see your parents again.”

Wide eyes shot to Roland’s kind ones.

“Right. You thought you were just talking to a friend. But did you hear what Baron Chapman was saying? The royals want to get rid of all the goblins. He is just like them. Do you think any Martian would care if every goblin died?”

Bog shook his head.

“Right. To them, you’re nothing but an evil waste of space. Oh, they’ll pretend otherwise, say that they’re looking out for the best for humanity, but that’s just a nice way to say that your kind are bad for the universe.

“If it wasn’t for me, Bug, you and your family, and your whole city would be dead. The rest of Mars doesn’t care about you, and would be happy if you died.

“I’ve kept you and your family safe, and what have you done to repay me? Spoken to the one person who could destroy this Institute? Stolen the future of every one of the scientists who has slaved to keep you alive these last hundred years?

“Is that what your thanks looks like?”

By now Bog was crying, claws biting into the skin of his arms, leaving bloody trails that mimicked the ones dripping down his face.

Roland sighed, clearly disgusted on top of being disappointed. But just like every other mistake Bog made, he was there to fix it, no matter how terribly Bog ruined everything.

“If he hadn’t been here, things could have just gone back to normal. But its too late for that.

“Things are going to change, Bug. And if you want to protect the people you love, you’re going to have to do exactly as I say.”

Bug nodded frantically.

“Right. First, there’s this.” A potion was placed in front of him.

Bog was hardly surprised at the pain that came from drinking it. It burned, and seemed to fill his whole throat with smoke even after he swallowed it all down.

When he coughed, he wasn’t surprised that no sound came out. Trust Roland to ensure that Bog couldn’t mess anything else up in the most efficient way possible.

“Now. If I can’t fix your mistakes, there might be some changes around here. Worst comes to worst, Eddy might trump up some show trial and drag you in front of the public to prove how evil Goblins are. You will answer exactly as you always have.”

Bog nodded again. Everyone knew in Science truth was the only answer. And as leader of the Institute, that was surely what Roland meant. He was, after all, their most decorated scientist.

“If you get taken from here, you will be in danger. Eddy’s cronies…they might give you nice things. Like a bed. Or warm meals. Do not trust them. Remember, Bug, that they only want to destroy all your kind. Being a dog keeps you safe, and that is the only way I can protect you and your family. Do you understand?”

He nodded.

“Fine. This is your last chance, understand?” When Bog nodded a final time, Roland sighed, as if putting aside all his better judgement to trust the boy. “Very well. You’d best hope that this bubble is strong enough to protect you from what’s coming.”

And the darkness descended.

Chapter Text

True to his word, Bog woke up with the familiar pain of someone popping his bubble via dissolving potion.

After centuries, it wasn’t a surprise, though he’d seen the reports on how the liquid should work, and Martians who had been pulled from bubbles while winged never mentioned the pain in their reports, just the frustration at interruption of their planned sabbaticals and a mild irritation at temporarily losing their wings. The acid should only hurt when applied to wings outside bubbles, but just like everything else Bog bucked the trend.

Another knock to prove that he was evil, perhaps.

Either way, when he blinked himself from the pain, he was only a bit surprised to find Eddy before him, along with several other of the strange assistants.

He shrunk under their regard, but then he looked around, and nearly passed out then and there.

He wasn’t in his cage.

The thought seemed impossible. Four years of personal time, and he had never been more than a few feet from his cage, ever.

But now…

He shuffled back, until he felt himself collide with softness. A couch. And beyond the Aides, a room. One that had pictures on the walls, which in turn had been wallpapered floor to ceiling in lush forest greens.

His mind whirled, too much new to take in, so he focused instead on the couch.

Plush. Maroon in color. Velvet - or at least soft in that way, with fibers that shifted beneath his hands and changed subtle color when he stroked it. He sunk into the fabric, the cushions overstuffed, equally plush behind him.

Soft. Warm. Enveloping.

All sensations that he hadn’t felt in almost longer than he could remember.

But. He wasn’t made for nice things, anymore.

Beneath his hips, as he moved back, the thin, elegant, fabric tore. When his hands scrabbled against the smoothness, his claws bit into the cushions. Behind him, the plates of his shoulders ripped apart the softness.

He jerked forward, off the beautiful thing, looking over his shoulder to find it ruined, green stuffing exploding out wherever he’d touched. It clung to the points of his plates, and he sobbed.

“S-s-sorry.”

His voice didn’t work, and that was only a blessing, but his sentiment echoed out into AR, and he hid his eyes in shame, already feeling the prickling of bloody tears, which would only stain the rug beneath his knees.

The rug, which was just as plush as the couch, but woven with designs of leaves and fauna, and also was being torn, even before it became splotched with red tears.

Above him, the Aides shared panicked looks, and then another bubble descended.

When he woke a second time, it was in a far more familiar room.

This time, there was no riot of sensation, no opulent pictures or plush furniture.

Instead, he sat on an examination table not unlike the ones back at the Institute, which had been padded with some kind of mushroom leather. The points of him still scraped it, but there was no stuffing to tear free, and he felt a sigh of relief before he even looked up to see the rest.

This time, only two people were in the room, though he sensed others beyond the door. Eddy and his tall friend were further away, sitting on simple stools, again not unlike the ones at the Institute, but clearly infinitely more comfortable.

Cautiously, he examined the room. Warm light, emanating from no set source on the ceiling, reminded him of Earth. Martian light was cooler, and the Institute matched that light. Here it was warmer, as if pretending to emanate from a sun 150 million miles closer.

The walls were white, just like at the Institute, but here it was a warm cream, not a cold frost. There were no pictures, and certainly no gaudy golden frames, but two large screens were hung on the walls, turned off but humming with a calm blue default color. Along the other wall was a row of cabinets, also painted cream, and there was a simple door in the final wall.

The room wasn’t tiny, but it was simple and familiar, as if someone had taken his own lab then turned up the comfort level just enough that his mind almost instantly quieted, the chaos of a few moments ago (of his time) almost instantly evaporating.

“I told you we should have started at the Repository.” The tall aide said.

Eddy huffed, but nodded. “Yeah. I see that now.”

Then he turned to Bog. “Do you remember me, Boggart?”

Bog nodded, moving back on the table so he could curl up into his familiar hunch. It was weird not being in a too-small cage. Maybe this was one of the bits of bribery Roland had warned him of.

“Cat got your tongue?” The other aide said, a wry smile on her face.

Eddy shot her a look, but turned back to Bog, clearly listening for an answer.

Bog shook his head, but opened his mouth to demonstrate his inability to speak. The time in the bubble had led to his vocal cords healing somewhat, allowing him to croak slightly, which Roland would have known to happen, given how many other times Bog had repaired his voice. So of course the croak was the intended response he was supposed to give.

Eddy’s eyes narrowed at the noise, and Bog swallowed. The man was probably disgusted by the sound - the scientists usually were.

"Sorry", he sent out in AR.

Eddy and the other Aide shared a look.

“What for?” The other finally asked.

Bog considered. “...everything?”

Brows raised, and she promoted. “Such as…”

“Umm.” He listed off on his fingers. “Sounding bad. Ripping your pretty couch. Staining your floor. Scaring your assistants. Being ugly -"

She held up a hand. “How old are you, Mr. King?”

He blinked. He’d never been called that before.

“Uh. Eleven? I think?”

Again a glance between the two aides.

Eddy answered this time. “Boggart, no one would blame you for damaging a couch. That was our fault for not thinking ahead.”

He stared at them. This must be another one of the bribes. Obviously he had acted poorly and ruined their nice things. Another example of Eddy being too nice to him, just like Roland had said.

But he wouldn’t betray Roland’s confidence by suggesting such a thing. It would be rude to point out he knew what they were doing, right?

Instead, he said, “You can just call me Bug. That’s what everyone at the Institute does.”

“What do your friend’s call you, Boggart? This - “ Eddy’s eyes flickered, as if he was checking his notes in AR, “ - PLUM person?”

“She calls me Bog. Mum did too. I guess you can call me that, if you want? It's shorter than my experiment name.”

The other aide winced, and Bog assumed that meant he had presumed too much, but Eddy was already speaking again.

“Bog, then. You can call me Eddy and this - “

“My name is Dr. Helena Kirkenstein, young man. But you can call me Helena.”

Bog’s eyes widened. He remembered that name, from an eons old memo.

“Oh. You’re from the Repository?”

The woman raised a brow, but nodded. “And how might you know that?”

Bog flushed - or would have, but he wasn’t sure his skin worked that way anymore. His cheeks did feel hot.

“Roland - The General, I mean, said the scientists weren’t supposed to talk to you. PLUM said it’s because you’re an ex?”

Helena snorted. “I think you’re thinking of my great grandmother. She dated Roland, briefly.”

“...and since then the Repository hasn’t let Roland make requests.”

“Is that why?” He nodded. “You’re in the Repository now. Does that bother you?”

He considered. Despite everything the memo and PLUM had said, none of the scientists had anything but respect for the Repository and the work they did. So he shook his head.

“Are you going to add me to the Goblin bubbles?”

Again he seemed to have surprised her. She shot a look towards Eddy, and he shrugged and nudged her to answer.

“...no. We brought you to the Awakening wing because we thought it might be more comfortable for you.”

“Oh. Thank you. It is.” Even if it was just a bribe, it was a nice gesture.

“Roland didn’t want to give you up. He said your bubble was lost.” Eddy said. “But a friend said you were still in the lab, and turned you over during the next inspection.”

Bog nodded. “Lots of things get lost in the Institute. Especially with all the records stuck in AR. Sir Roland does his best, but I guess he can’t see the records anymore either.”

“But you can?” Helen asked.

Bog considered. He sent out a quick query, and to his surprise the Institute data unrolled around him. Apparently, the ‘not-human’ loophole still stood, and extended even to breaking the normal data-quarantine.

“Yes? I’ve always been able to see everything, all the way back to when PLUM first gave me AR access.”

“Interesting. And Roland knows you have it?”

‘Of course’ was on the tip of Bog’s tongue, but he paused. Did Roland know he had AR? They’d only ever spoken in the Real, after that first disastrous conversation. But Bog had only been only able to get his first wings because of the research he and PLUM had done. At least, that’s what PLUM had seemed to think. And they’d noted all their research down on Bog’s file…both of them had been equally sure that their master would have wanted everything they knew to be documented, even if the normal scientists couldn’t access the full information.

“He…told me to answer all your questions just like I did back at the lab? So I think he knows?”

Eddy muffled a cough into his hand, and Helena looked at her friend with raised brows. The coughing fit subsided, and a moment later Eddy dropped his hand and said, very serious, to Bog,

“If that’s the case, I’m sure he would be very pleased with your honesty.”

Bog nodded. It was terribly important to do everything that Roland wished him to do.

“I hope so! I’m not very good at following his orders. But I try super hard, even when it’s really, really difficult.”

“Can you give us an example?” Helena prompted.

“Well, I mean, I don’t have the right wings yet. Even after all he’s done to help me. That’s what my real experiment is for.”

Both Eddy and Helena’s eyes narrowed.

“...explain.” Eddy said.

—-

After a lengthy explanation, with Bog providing all the documentation from his and PLUM’s research along with all the relevant experiments on both himself and the other human test subjects over the years, Eddy held up a hand.

“So you’re telling me that your ‘real’ experiment is to prove that you wanted to look like this, and that would somehow prove that the people in the Goblin bubbles are not evil?”

Bog smiled, forgetting how ugly he looked for a moment, until Helena flinched at the sight. He dropped the smile quickly after that, but kept talking

“Right! And to do so, I just need to make wings.”

“That is the most idiotic -” Helena hissed, before Eddy kicked her shin.

He said, instead, “So you’ve never succeeded at Roland’s request?”

Bog sighed and shook his head. “No. I thought I got close when I first got normal wings, but they weren’t good enough.”

“You have wings?” Helena seemed shocked.

“Oh, no, not now. The dissolving potion burns them off. Along with all my other fields. But that’s good, because then I get to try again! I’m sure I’ll get it right someday! I just need to concentrate really hard, and I’ll be able to prove to everyone that I - and all the rest of the goblins - aren’t evil.”

His grin faded, and he added,

“But I haven’t been able to do it yet. Please, I know you think goblins are evil, but I promise, my mom and dad, and all the rest of the people in the goblin bubbles, they’re not. I might not be good enough, and hurt people, and cause problems sometimes, but they’re good. Maybe - maybe if you brought some of them out, you’d see! It’s not really good to do science on only one subject. To prove something, you kind of need a range.”

“...so what do you suggest?” Helen asked.

Bog considered. “Um…I guess you could find more goblin kids? I know I’m really extreme, but there’s got to be other kids like me. Or maybe adults? Dr. Dor and Dr. Ty proved ages ago that the thing that makes goblins isn’t a disease. It isn’t contagious. So it wouldn’t be dangerous if you opened up some more bubbles. Then you could see if other goblins could change how they look, even if I can’t.”

His mind flickered, imagining the best way to repeat the experiment and make it real science. Just like what was done to him…

“It probably wouldn’t even take 400 years! And I’m fine in a small cage, with cheap food, so it wouldn’t even cost much, even with a dozen or so other people. Most goblins wouldn’t have AR, so it's not like they could be distracted like I was. And they wouldn’t have to start from scratch! We’ve got all my data, and everything Dor and Ty and Sam and the rest did. I know Roland doesn’t like to share data, but if we had a team that all agreed with the goals, and had gone through desensitization so they wouldn’t be bothered by experimenting on people, then it might not be a problem? You might even be able to do easier things - like cutting off limbs and stuff. I’ve grown stuff back, so other people might too, and that proves that intention does play a part. A lot of my weirder fields fix problems I have - that’s what Roland means when he said I get distracted - so if you don’t burn off their eyelids or tie their arms together then maybe they could concentrate better than…I…could…”

He trailed off, seeing the horrified expressions on the two aide’s faces.

“...ah. Um. No one wants more goblins free, though. Right. I sometimes forget how much that bothers people. I mean, just look at me!” He chuckled a bit.

Helena stared, but Eddy seemed to recover faster.

“...why don’t we pause for some dinner? What would you like, Bog?”

“Um…PLUM once was able to get me a hot dog. Uh - that’s an ELF thing - a sausage in a bun…unless that would be too much?”

The last bit was prompted by Helena standing suddenly, and leaving the room, the door slamming behind her.

Eddy didn’t flinch, and smiled back at him, even though there was a tension in his jaw that was hard to ignore.

“Y’know, I bet we could find a ‘hotdog’ for you, buddy. It’s the least we could do.”

—-

The video shows a sobbing woman in a corridor, slumped against the wall, hands over her eyes as she shakes.

A small man exits the room beside her and shuts the door. The smile on his face drops as soon as the door closes, and he places a hand on her shoulder.

The audio barely picks up her mantra.

“Fucking hell. Fucking hell. Fucking - “

It stops when she feels the man’s hand, and she turns to look up at him.

“Jeezuse Christ, Ed.”

The man just squeezes her shoulder.

“You know, I thought my gran-grandmother was crazy for hating him so much. I thought you were. But - “

“First time you see what he does to people, that changes.” He says.

“Fucking Hell.”

“You know, my father died in a race against him. Blew up the Hummingbird 0010. Fastest bird in the fleet. I was two when it happened. I thought my mum was crazy for blaming him. Then I took a course at the Academy under him.”

“...and you went public with what you saw.”

“No. I went public with the things that were fit to be public. Somehow 90% of what he did never hit the news. Or was recorded in the military files. And that was with my testimony, and the fact that my mother and sister hated his guts and were gunning for him the entire time. The accusations just…disappeared. Like so much smoke.”

The woman shakes her head, and wipes her cheeks.

“Fucking hell.”

“Yeah.”

“...my mother is thinking of lifting his ban on Repository Requests. Because it was just a ‘silly grudge’ that GranNana had.”

“Think you can change her mind?”

The woman shakes her head. “I don’t know. That -" she gestures behind her. “Has been going on for Five Hundred years. 250 Sols. And no one has ever questioned it.”

“Anyone who did had ended up dead. Have you looked at the files ‘our friend’ has sent over?”

The woman gives a broken chuckle. “Which ones?”

“There was code running for 300 of those years that alerted him if anyone ever noticed that kid was human.”

The woman closes her eyes. “How many times was it triggered?”

“Twice times. Guess what happened each time?”

“Accidents?”

The small man nods. “And no one ever wondered. About any of the accidents. Those five, or the 478 other ones. Until Her Majesty asked where Illia De Plume went.”

“Fucking Hell. Do we even have a chance, Eddy? At beating him?”

Eddy slides down the wall next to her, leaving them both sat on the floor.

“I don’t know. But don’t we have to try?”

—--

Things went exactly as Roland had said they would. Eddy handed him off to Helena and her friends, and then the odd aides fed Bog real food, and gave him a bed with blankets, and didn’t bubble him even though it was obvious that they were all deeply disturbed by his looks.

And they were constantly asking strange questions. Really strange ones. Like -

“What do you want, more than anything else?” A new aide asked, one who looked like they always had a clip-board in their hands, even if such things hadn’t been necessary for a thousand years.

“Um. I’m supposed to get wings?”

The aide looked over their glasses - another strange, completely unnecessary thing - and made a mark on an AR file so well protected even Bog couldn’t see it.

“As I understand it, that is your job. What is it that you want for you?”

“Oh! I’d…I’d really like to see my mum and da again. It’s…it’s why I’ve been doing everything.”

And then the aide said nothing as Bog found himself crying, though they flinched from the look of him just like everyone else, but extended a hand to pat at his shoulder.

“S-s-sorry. I just…Cousin Ronan said I was supposed to protect mum, and instead I got her in trouble by being such a bad kid, and…”

The aide’s words cut through his tears like a knife. “He told you to protect her?”

“Yes?”

“Interesting.” And then another note on the file.

They turned thoughtful eyes on him.

“Have you ever considered your form might come from that desire?”

Bog looked down on his hideous self. “...what?”

“Your form. Many would, at a glance, see some kind of knight. Would you agree?”

He considered for a moment, then the impossibility of it had him shaking his head.

“No. Knights are cool. They’re…they’re heroes that save people and always do the right thing. This -" He shoved a shoulder plate, hard. “ - this is ugly. Ugly people can’t be heroes. Everybody says so. And even then, this is so much better than I was.”

“Oh? What did you look like originally?”

Bog shuddered, not wishing to describe the ugly grub thing he’d begun as, and sent the images over to the aide while trying not to look too close.

They turned away, hand flying to their mouth, hiding a retch at the sight, cracking a façade that had been near iron-clad since Bog first met them.

But unlike his familiar scientists, the aide took a moment to compose themself, and turned back.

“...I see.”

“Right. Hideous.”

The aide raised their brows, and referred to an earlier note. “You said your first thought, coming from your first bubble, was ‘not yet’?”

“...so?”

They looked above their glasses, and gave a wry smile. “Very few of us look pretty in the womb. Your caretakers even said it themselves - it was as if you were ‘unformed’. And even now you still seem to be growing into yourself.”

The thought seemed terribly silly. “You sound just like PLUM.”

The aide blinked, and turned back to their notes, as if shrugging aside an earlier distraction.

“Ah, yes, your friend. Would you tell me more about her?”

—--

And on and on it went. He only found out later that the people he spoke to in the strange cream offices were scientists in their own right, technicians of the Repository, which had a whole wing of scientists just like the ones back in the Institute labs.

But they were different. Not just because they saw him as human and asked strange questions. But because their science didn’t seem to make any sense.

He was familiar with the ways things should go. He’d get poked and prodded and have samples taken, then back to the bubble or the cold floor of his cage. He was treated no different than any of the animals, and that was the way it should be.

At the Repository, people kept talking to him. Asking his opinion about things. Did this hurt? Could he flex that? What did he think of this color? Could he taste that flavor?

On and on, and somehow they were doing science with his words.

He saw some of their data, public enough on the general network. It seemed that the Repository scientists were ecstatic over receiving a goblin to test their theories on, after four centuries under a total ban of any ‘twisted’ bubble being popped.

But there was no mob of mad doctors descending upon him. He met perhaps ten people total beyond Eddy and Helena, each of whom barely even touched him, and if they really, really needed a sample it was taken with the utmost care and concern for his comfort.

It was insane. And Bog was deeply grateful for Roland’s warning, because he could so easily see himself slipping into imagining a future like this, as a pampered prince, his every need met, while the real scientists at the Institute slaved away in constant danger.

Vaguely, he remembered the children that the Institute had studied being treated much the same, but that was truly silly; he was no Martian and certainly didn’t deserve the same care as the children whose fledgling wings had so fascinated the Institute a hundred years before.

The tests were strangely similar, though, to that long ago experiment. Cognitive tests, ones examining his reflexes, others looking at scholastic ability…he frankly didn’t see the point of any of them, as it wasn’t as if any of the Institute scientists would need any of the data when he was returned to them.

“...you expect to go back to the Institute?” Helena said, surprised.

“Well, yes. As soon as you’re done with me, I’ll need to go back to work!”

“Didn’t they have rules back on Earth about child labor?”

Bog laughed. “I’m not a kid, I’m a goblin!”

Helena got quiet after that, and Bog turned back to the strange tests, breezing through all the kiddy questions easily, and skipping to the more difficult maths, glad for the distraction as he got down to differential equations.

That was another thing; the Repository scientists seemed intent on treating him like a child, and that meant regular meals and school. All wastes of time, to his mind. But none more so than the third requirement - exercise.

Bog was familiar with horror from the aides and scientists - though it came mostly from his words, now that they seemingly had become accustomed to the sight of him.

But the medical doctor who examined him had gone all hard when looking over his medical charts, and had actually walked out of the room when Bog had casually mentioned being locked in a cage in the Institute.

It was this doctor - who introduced herself as Cypress - who had told him to lay flat on the examination table, then thrown a tray at the wall when he was unable to stretch out; his muscles seizing as they were unable to relax from his ever-present crouch.

“The cage was too small.” She raged at Helena, later. “Even the mice had enough room to breathe! But that kid, he hasn’t been able to lay out flat for more than a year of his time. They never thought to move him into a bigger cage?”

“Dr. Ty did!” Bog interrupted, shouting into AR to be heard. “He wanted to make me comfortable! But that meant bringing me out of the cage-block. Where other people might see me. And that wasn’t fair to them.”

When Dr. Cypress and Helena stared at him in confusion, he added, “Because I’m so ugly, you see? The cages all had screens so no one had to see me. They had to put me back in the regular cage, or else everyone would have been sick all the time.”

His words didn’t seem to have the placating effect he thought they would, but it was little surprise that Dr. Cypress instituted a daily exercise routine that was at least familiar in the amount of pain it put him through, even if he didn’t understand the point of it.

Why was it important to stretch his back out, or touch his toes, or uncurl all his fingers? It wasn’t as if he was ever going to use his body. But Dr. Cypress didn’t seem willing to accept his excuses, and so he had to stand straight, and stretch out his legs, and do laps up and down the halls until he found himself shaking under her watchful eye.

“I have a daughter, you know.” She said, once. “My little Juni. Just two Sols old. If anyone did something like this to her, I’d tear the world down.”

Her words didn’t make any sense to Bog. No one had done anything to him. If anything, he’d done this to himself, by either wanting this, or being a bad kid.

But other than the strange aide with the invisible clipboard, none of the scientists seemed willing to listen to his insistence that this was all his choice, his decision, and he should be allowed back to the institute as soon as possible.

He was, frankly, a bit grateful when someone tried to get him back.

—

“Where is my specimen?!”

Bog hadn’t known who to expect when the shout went across the AR of the Repository, waking him from an early morning nap beneath a “natural light” mirror that Dr. Cypress had assigned him to.

Yawning, he roused himself enough to wander out towards the source of the shout. It wasn’t unusual for him to be alone during exercises; after Dr. Cypress had confirmed that he would do as she asked even without her immediate presence, she showed him the bathroom (unnecessary) and where he could rest between sets (as if he would rest for something as minor as a little pain) and then went off to do whatever her normal job was.

It was almost like they were giving him space. He didn’t get it, but assumed he wouldn’t be there long enough to understand their logic.

And the angry voice certainly seemed like it would make that thought come true.

He expected Jennifer. Or maybe one of her assistants. Or one of the other Ambassadors.

Instead, standing in the empty ‘lobby’ entrance to the lab, was Sam.

But Sam as he’d never seen them before.

Huge, bright, electric blue butterfly wings flared up from their back, matching their angry gestures as their host argued hotly with the receptionist at the door.

Everything else faded away as Bog stared at Sam’s new wings.

This must be what Roland had expected from him, and with a dozen more months of research and a living, breathing example in front of him, suddenly Bog understood.

Sam’s wings were gorgeous. They weren’t made up of a single field; no, instead there were layers, dozens upon dozen making up each petal-like wing, divided just like butterfly wings into two matching sets, clear delineation between the four panes, larger to the top, smaller to the bottom. Black lines outlined the edge of each wing, the fields there thickening and attaching to the back in a way that was far more physical than any prior wing Bog had seen. Black veins shot through the wings, anchoring the whole together, even as the base fields shifted and moved, spots growing and fading as the whole roiled under Sam’s ire.

Sam had been bubbled for five Sols growing these, and their existence proved every one of Ilia's arguments for keeping her child safe. Bog could recognize two dozen different kinds of fields, and could bet each was linked to a different ability, and then interact to only create more, stranger, abilities.

Ignoring the mere beauty of Sam’s wings, they represented a massive breakthrough in Field science.

But the beauty really couldn’t be ignored, because no one could look away from the splendor reaching up behind Sam, no matter that Sam was currently shouting very loudly at anyone within either hearing or AR distance.

The receptionist gaped, doing his best to enter in Sam’s questions and find someone who could answer, but every few moments would glance up and freeze, mesmerized by the flapping blue wings. Then Sam would shout again, and the cycle would continue.

There was already a request summoning Eddy, but he was not actually an employee of the Repository, and was frequently half a planet away. Helena was on her way, but did not live at the Repository. In fact, given the hour, it was likely that only Cypress and Bog himself were there, both being early risers.

There was no one else to save the receptionist.

So Bog stepped forward, and coughed.

Sam turned, and blanched.

“You let it out?!”

Technically, he was probably not supposed to talk to Sam. He hadn’t ever before. But if he could save the poor, cowering man at the counter…he had to try, at least.

Dr. de Plume. It's okay. I haven’t been causing any trouble.

Sam recoiled as if struck.

“What did they do to you?”

Nothing. Nothing will mess up your experiments.

Their eyes widened. “They made it talk?!”

He raised his hands. No, no. Just in AR.

In anyone else, the next thing would have been Sam fainting away. Instead they slumped, and their wings floated them as if they were on a couch.

“Ah. You’ve met our newest addition.”

Helena strode through the doors, the airlock cycling with a whoomph.

Sam turned to them. “What the hell, Helena? Stealing my research? Letting it walk free? Making it talk?”

“He has always been able to talk. You just never asked in a way he could answer.” Helena replied. “Now I understand congratulations are in order?”

Sam looked blank, then looked behind themselves at their new wings. “Oh. Uh. Thank you.”

“I would have thought you’d be more interested in testing your own creations, rather than trying to claw back an old experiment.” Helena continued.

Sam shoved themselves up. “Excuse me? The Bug is a primary experimental subject. Without it I cannot continue my work. Everything is a mess at the Institute, and I wake up to find that you’ve stolen -”

“How recently did you Awaken, Sam?” Helena smoothly interrupted.

“Five hours.” They answered rather flippantly, though Helena swore. “But that doesn’t - “

“You should be at an Awakening clinic.”

Sam snorted. “I have work to do. Work that isn’t getting done because of you and whatever bullshit politics Eduardo - “

Bog saw the moment Helena decided she’d had enough, faster than anyone else he’d met, except perhaps Dor. Her eyes hardened, and he was already flinching before she spoke.

“Did he even tell you that your mother is dead?”

Sam paused their tirade, confused.

“What? Mum’s fine! Saved a message for me and everything. She - “

Their words trailed off as their eyes flickered, scanning through AR, then they stumbled again.

Bog knew the files they were querying, knew the empty expanse of the censored records, stripped of any mention of the once preeminent coder of the world, knew the moment Sam reached the same conclusion as he, and watched as they broke.

“Mum - she’s - “

“She overstepped her bounds, and was killed for it.” Helena said, all emotion wiped from her voice.

Sam’s eyes snapped to the scientist.

“No. That’s not - “

“If you won’t go through an Awakening, then you must know this. The Royal Institute has been accused of gross negligence following her death. Twenty five experiments have been seized, including the “Bug” specimen. All others have been halted for the duration of the investigation.”

Helen drew herself up, her back straight enough to snap a ruler.

“Two hundred scientists have been bubbled pending interrogation. Thirty five more have been held in custody. Fifty seven former Institute employees have been recalled, eighteen of whom have been removed permanently from their positions under accusations of scientific misconduct.”

The glare she gave Sam would have frozen methane.

“Whatever he told you, it was at best a vast simplification, at most a lie. Authorities have been notified, and are on their way now, and you will be remanded into their custody. You will have no further contact with any of your experimental subjects, key of which is the young man you tortured for over four hundred years!”

Sam gaped, and Bog suddenly understood why ‘Awakening’ was so important. A mere five Sols, and the world had changed such that no one would be surprised if Sam went mad under the onslaught of new information.

Instead, their mouth snapped shut, and they drew themselves up, to their full height, wings flaring behind them.

“This is a vast overreach of government authority. To use my mother’s death for your own political ends is sick, and The General will see justice served for it.”

Their eyes glanced to Bog.

“And if your plan is to dress a monster up in a suit, simply for some stunt, you will see true science win out, and this farce will fade back to nothing.”

They turned back to Helena, even as guards in slim-fitting Martian Armed Forces uniforms arrived, weapons drawn. They held out their arms, unresisting, as they were pulled away, back through the airlock.

“I expected better of you, Hel.”

—-

Helena slumped into a seat after Sam had left, and Bog found himself shivering in the perfect temperature of the lobby.

The guards hadn’t even glanced at him, as they’d dragged Sam away. Even here, the AR shields hid him from the world.

He pressed himself against the nearest wall, and slid to the floor, careful not to scratch the creamy stone walls.

“I’m sorry you had to see that.” Helena said, even as he curled in on himself.

“Is it true?” He asked, unwilling to even glance into AR for fear of what it might say.

“...yes. The Institute has been shut down. They can’t hurt you anymore.”

He jerked his gaze to her.

“No! They weren’t doing anything wrong!”

“Bog - “

“You have to tell them! Mars needs the Institute! I’ve got to go back!”

She wiped a hand down her face, her own gauzy brown wings spinning into a semblance of order.

“Bog. You can’t - “

“No! Nobody did anything wrong! It was - It was me! Because I’m bad. I hurt people. Not the scientists! Please! Don’t send them away!”

He had stumbled forward, and had grasped the loose pants of her suit in one clawed hand, tearing holes into the thin fabric.

At the sound of a rip, both he and Helena glanced down, seeing the damage caused by his hands, and he tore his hand back, only ripping the fabric further.

“S-see? It’s me. I- I destroy things. I can’t -I can’t help it. I’ve got - I’ve got to -"

He stumbled back, breathing heavy, image in his mind of the cruel way some of the Ambassadors treated Sam, the little sneers and rolled eyes, the way the fielder hadn’t been able to speak after Dor had died, and the way the cops of his world would have dealt with someone like that. All the little things that he and PLUM had done to make their life easier, and how their life would be stuck in a cage with people who might burn off their new, beautiful wings…

“It’s my fault. This is all my fault. I’ve got to - "

Elsewhere, in a world outside his head, Helena was reaching forward, hand hovering, uncertain of how to comfort the panicking child.

“Bog, don’t - “

But it was too late, and he curled in tighter around himself, and pulled in, and in, and in, wings unneeded when the power was his and he had a whole world to protect, and tore himself out of the world he was hurting.

—-

He did what?

Bubbled himself. Like - like the old families can do. But whatever Awakening condition he had, it’s incomprehensible to the coms.

Shit. Do we have enough dissolving field to bring him out?

Should we? If what he said about wings was true, it could hurt him more.

He’s a scared kid, Hel. We can’t -

How many scared children do you think we have in the Repository? Is it fair that we take time away from them, for a child that wants nothing to do with us?

The trial…

He isn’t the witness you want, Eduardo. Stick him in front of the King, and he’s just as likely to sit mum for Roland’s pleasure, and undo everything we’ve worked for.

But -

Or he’ll speak, and tell them just how desperately he wants to return to the lab. How he deserves what has been done to him. And how will the royals take that? Can you imagine a single member of the committee hearing anything but what they want from that? He’ll be back in his hands faster than frost on Io, and no one will question his supremacy for another five hundred years. Is that what you want?

…No. It just…it just seems wrong.

Wrong or not, this is the Repository, not your Bureau of Investigations. We have a responsibility to obey the wishes of those within our walls. And in this case…

He just wanted to protect us. And we - we failed him.

Perhaps. But what else can we do?

Chapter Text

When Bog opened his eyes again, it was with familiar pain, but also with relief. Roland was standing before him, shining in his best armor, the kind he only brought out for the most prestigious occasions, like press briefings. Green metal, with gold embellishments, matching the shining gold of his hair and deep green of his eyes, face made to be smiling but now contorted in serious debate.

He was stunning. The whole room seemed to glow with his mere presence, and Bog was warmed at the honor of sharing such a space.

His hero was speaking to a room of other Martians, halfway through a statement -

“ - have made claims of impropriety. But would you believe them, when THIS is the subject?”

All eyes turned to him as the AR shield fell, and he closed his eyes tight at the screams. Of course. They were accusing the Institute, accusing Roland, of terrible things. What better evidence was there, than his existence?

He kept his eyes down, as the room erupted in argument, but observed in AR.

He stood besides Roland in what appeared to be some kind of courtroom, but unlike any he’d ever seen on TV. On a dais before them a family sat, their robes even more sumptuous than those of the Institute inspectors. The man wore a thick cloak in deep red, trimmed in white and purple, a matching crown upon his head and metal armor that moved like fabric, effortlessly shifting as he did. Besides him sat a woman, equal in his apparent age of mid-forty, thinner lines on her face but kindness in her eyes, except when she glanced at Bog, brows raised. She wore a tiara with sun-spikes and a purple gown with intricate stitching matching the arid geography of Mars. Across her lap was a sword, and at her side two children, barely toddlers, in equally voluminous outfits, but with undergarments that seemed almost sewn on, until they shifted and shimmered, and one realized that they wore uniforms of equal field and fabric. The children stared at Bog with unabashed curiosity, even while the rest of the room flinched away. All four had wings, the adults with a halo of shifting fields to rival even Sam's expansive wings, though none as solid as the fielder's. The children both had simple, childish wings like Bog's own, a feathery plethora of overlapping but distinct fields, but in far deeper colors of red and umber, perfectly matched by their outfits. Fit for a prince and princess, for that was surely what they were.

The rest of the room was big, and packed with winged Martians in a thousand different styles of couture, though none so elaborate as what must be the King and Queen. Bog felt at least a hundred different eyes on him, and he couldn’t help but sink in on himself under their combined, horrified, regard.

Somewhere to his right he recognized Eddy, in a similarly elaborate outfit, tailored to his smaller stature, looking deeply worried, shadowed by an equally grim Helena. The two stood level with Bog and Roland, separated by nothing but an ocean of stone, marble flooring that Bog vaguely recognized must have been grown using techniques discovered at the Institute.

Roland coughed and drew eyes back to himself, and Bog tried to listen, he really did, but it was just so much. So many people. The sound alone was overwhelming; little whispers of fabric as the gathered masses shifted, creaking of leather and jingling of jewelry. The sound of a hundred people breathing, muttering to themselves and whispering to their neighbors. Watching. Judging. Seeing him.

But he couldn’t panic. He was here to represent the Institute, and he had to do whatever Roland asked, as best he could. All he could do was pull AR tight around himself, silencing the world as best he could, drawing up blinders until his senses narrowed to nothing but Roland’s lofty voice and the monarchs they both equally served.

The King held up a regal hand, and Bog noticed the odd appearance of calluses, so like his father’s as to seem impossible. The man had pale skin, but in the way that hinted to a dark complexion had he ever experienced the warm sun of Earth. There were smile lines around his eyes and lips, and a calm kindness that silenced the room better even than Bog’s AR could manage.

He looked straight at Bog, quirked a brow, and asked, “And who are you, young man?”

It shouldn’t have felt any different than earning Roland’s attention, and yet it did. Bog felt himself stand straighter, meeting the man’s eyes because that was what he deserved, and strangely felt no desire to hide from those warm brown eyes. He couldn’t feel shame standing before the man, for nothing was expected of him. Alone, in the whole room, was a look not of horror, but of thoughtful curiosity, and infinite patience, all judgements set aside until Bog spoke.

Bog swallowed hard, and glanced towards Roland, only to see him jerk his chin slightly up.

Had he been more used to looking people in the eye, he might have noticed his hero’s sightline was over his head, directed to his opposition. Had he more familiarity with sarcasm, rather than several years hashing out the vagaries of human expression with a literal computer, he might have considered the gesture an insult rather than a push forward.

He might have gotten it right.

Instead, he bowed as low as the monarch deserved, and announced through AR:

“My name is Bog King, sire. I am 11 years old - that’s 6 Sols - and am a Dog Goblin from the Earth city of New York. I am the second oldest experiment at the Royal Institute, with designation 010-G, and the last of the original specimens still living. I wish to return to my experiment as soon as possible, to prove to the world that Goblins like me can be good citizens of Mars."

---

What happened next was pure chaos. Shouts, screams, accusations and AR battles as the courtroom erupted.

Had PLUM been at his side, Bog might have been able to understand it, his friend easily able to interpret the social shifts that swirled around them, ebbing and growing, dissipating and mutating as something as innocuous as his mechanical voice in AR hit the scandal hungry social circle of the court.

But PLUM wasn’t there, and Bog was unfamiliar with the voices that rose around him, so different in their needs and motivations than the scientists he’d cared for over the last hundred sols. This AR wasn’t his familiar little pond, but an ocean he was drowning in, dozens of different channels overlaying each other as different factions shouted amongst themselves and then out into the Real.

It was too much, and he scrabbled for the quiet of his mind, shutting down his senses as he’d trained himself over his confinement. Eyes unfocused. Listening to his heartbeat, not the roar around him. Hands clenched, pain a familiar background wave, even as his palms bled from his claws.

Even the King couldn’t control the chaos, and Roland wasn’t even trying, so what else could Bog do?

So focused on blocking everything out, he was completely unprepared for a solid weight shoving him.

Blinking, he looked down to find one of the children - the one with reddish wings - sat at his feet, from where they had run bodily into him after toddling their way off the dais.

Already, red scrapes were growing on their face from where they’d hit his side and skidded along the rough plates of his hide.

In the way of little children, they looked confused, as the pain trickled into their mind, and their brows knotted before what was sure to be a screaming wail.

He was just aware enough to catch the other before they did the very same, a field flicking out faster than his hand could and swirling the brown-winged child up before they could endanger themselves like their sibling.

Of course, that was just as unacceptable as actual pain, and the little thing squirmed against the field, wings fluttering as they tried to escape, mouth twisted in a scowl as they struggled towards Bog.

And they were strong. It seemed impossible for such a little body to be able to shove so effectively, but Bog’s fields flexed under the determined kicking from the child.

On his other side, the red-winged one was instantly distracted by their sibling’s new game, and toddled to their feet to also run towards Bog, and now he was holding up two field barriers between himself and the squirming toddlers, both of whom seemed intent upon injuring themselves against every one of his spikes.

In the back of his mind, he could hear the roar of the crowd react to this, whispers of hurt the heir and a fielding animal? and how DARE - all drowned out by his panic at the two terrors.

Frantically he raised his eyes to the Queen, only to find her with brows raised to the skies.

“S-Sorry!” He shouted into AR, and tried to push them towards their mother, bodily picking them up with his fields and depositing them as close to their thrones as possible. Which was near pointless, since the instant their little feet hit the ground they were dashing back towards him, the new game in their minds apparently ‘get to the monster’ no matter the danger.

How can it - How DARE - since when - did he really - little terrors -

He fumbled backwards under their onslaught, falling with a painful thump, pulling a protective shield around himself, even as he shoved them back again, this time rather pointedly at their mother’s feet.

That startled the Queen, but not in the way he’d expected.

The beautiful, severe woman took one look at her pouting children and Bog’s flustered fumbling, and burst out laughing.

The King jerked, and swiveled to look at his wife, only to find her bundling their children close to herself and chuckling.

“Oh, Karles, look! The Bug can hold his own against our terrors!” She laughed again, and tightened her hold on the wriggling pair. “No one said goblins make good nannies.”

No one had come to Bog’s assistance after his tumble, so he was still on his knees when he bowed again.

“S-sorry! I didn’t mean to - it’s just that my skin is rough - I didn’t want to hurt them!”